Settlement of the combination of Novozymes and Chr. Hansen Holding successfully completed
Read the rest here:
Settlement of the combination of Novozymes and Chr. Hansen Holding successfully completed
Author Archives: admin
Effect of a retinoic acid analogue on BMP-driven pluripotent stem cell chondrogenesis | Scientific Reports – Nature.com
James, S. L. et al. Global, regional, and national incidence, prevalence, and years lived with disability for 354 Diseases and Injuries for 195 countries and territories, 19902017: A systematic analysis for the Global Burden of Disease Study 2017. Lancet 392(10159), 17891858 (2018).
Article Google Scholar
Zhang, W., Ouyang, H., Dass, C. R. & Xu, J. Current research on pharmacologic and regenerative therapies for osteoarthritis. Bone Res. 4(October 2015), 15040 (2016).
Article CAS PubMed PubMed Central Google Scholar
Yamanaka, S. Pluripotent stem cell-based cell therapyPromise and challenges. Cell Stem Cell 27(4), 523531 (2020).
Article CAS PubMed Google Scholar
Jevotovsky, D. S., Alfonso, A. R., Einhorn, T. A. & Chiu, E. S. Osteoarthritis and stem cell therapy in humans: A systematic review. Osteoarthr. Cartil. 26(6), 711729 (2018).
Article CAS Google Scholar
Craft, A. M. et al. Generation of articular chondrocytes from human pluripotent stem cells. Nat. Biotechnol. 33(6), 638645 (2015).
Article CAS PubMed Google Scholar
Smith, C. A. et al. Directed differentiation of hPSCs through a simplified lateral plate mesoderm protocol for generation of articular cartilage progenitors. PLoS One 18(1), e0280024 (2023).
Article CAS PubMed PubMed Central Google Scholar
Loh, K. M. M. et al. Mapping the pairwise choices leading from pluripotency to human bone, heart, and other mesoderm cell types. Cell 166(2), 451467 (2016).
Article CAS PubMed PubMed Central Google Scholar
Chijimatsu, R. & Saito, T. Mechanisms of synovial joint and articular cartilage development. Cell. Mol. Life Sci. 76(20), 39393952 (2019).
Article CAS PubMed Google Scholar
Humphreys, P. A. et al. Developmental principles informing human pluripotent stem cell differentiation to cartilage and bone. Semin. Cell Dev. Biol. 127(July 2021), 1736 (2022).
Article CAS PubMed Google Scholar
Sumi, T., Tsuneyoshi, N., Nakatsuji, N. & Suemori, H. Defining early lineage specification of human embryonic stem cells by the orchestrated balance canonical Wnt/-catenin, activin/Nodal and BMP signaling. Development 135(17), 29692979 (2008).
Article CAS PubMed Google Scholar
Row, R. H. et al. BMP and FGF signaling interact to pattern mesoderm by controlling basic helix-loop-helix transcription factor activity. Elife 7, 127 (2018).
Article Google Scholar
Pignatti, E., Zeller, R. & Zuniga, A. To BMP or not to BMP during vertebrate limb bud development. Semin. Cell Dev. Biol. 32, 119127 (2014).
Article CAS PubMed Google Scholar
Ray, A., Singh, P. N. P., Sohaskey, M. L., Harland, R. M. & Bandyopadhyay, A. Precise spatial restriction of BMP signaling is essential for articular cartilage differentiation. Development 142(6), 11691179 (2015).
Article CAS PubMed PubMed Central Google Scholar
Kobayashi, T., Lyons, K. M., McMahon, A. P. & Kronenberg, H. M. BMP signaling stimulates cellular differentiation at multiple steps during cartilage development. Proc. Natl. Acad. Sci. U. S. A. 102(50), 1802318027 (2005).
Article CAS PubMed PubMed Central Google Scholar
Yoon, B. S. & Lyons, K. M. Multiple functions of BMPs in chondrogenesis. J. Cell. Biochem. 93(1), 93103 (2004).
Article CAS PubMed Google Scholar
Oldershaw, R. A. et al. Directed differentiation of human embryonic stem cells toward chondrocytes. Nat. Biotechnol. 28(11), 11871194 (2010).
Article CAS PubMed Google Scholar
Wang, T. et al. Enhanced chondrogenesis from human embryonic stem cells. Stem Cell Res. 39(May), 101497 (2019).
Article CAS PubMed PubMed Central Google Scholar
Diederichs, S., Klampfleuthner, F. A. M., Moradi, B. & Richter, W. Chondral differentiation of induced pluripotent stem cells without progression into the endochondral pathway. Front. Cell Dev. Biol. 7(November), 110 (2019).
Google Scholar
Kawata, M. et al. Simple and robust differentiation of human pluripotent stem cells toward chondrocytes by two small-molecule compounds. Stem Cell Rep. 13(3), 530544 (2019).
Article CAS Google Scholar
Weston, A. D., Chandraratna, R. A. S., Torchia, J. & Underhill, T. M. Requirement for RAR-mediated gene repression in skeletal progenitor differentiation. J. Cell Biol. 158(1), 3951 (2002).
Article CAS PubMed PubMed Central Google Scholar
Pacifici, M., Cossu, G., Molinaro, M. & Tato, F. Vitamin A inhibits chondrogenesis but not myogenesis. Exp. Cell Res. 129(2), 469474 (1980).
Article CAS PubMed Google Scholar
Hoffman, L. M. et al. BMP action in skeletogenesis involves attenuation of retinoid signaling. J. Cell Biol. 174(1), 101113 (2006).
Article CAS PubMed PubMed Central Google Scholar
Langston, A. W. & Gudas, L. J. Retinoic acid and homeobox gene regulation. Curr. Opin. Genet. Dev. 4(4), 550555 (1994).
Article CAS PubMed Google Scholar
Boncinelli, E., Simeone, A., Acampora, D. & Mavilio, F. HOX gene activation by retinoic acid. Trends Genet. 7(10), 329334 (1991).
Article CAS PubMed Google Scholar
Bel-Vialar, S., Itasaki, N. & Krumlauf, R. Initiating Hox gene expression: In the early chick neural tube differential sensitivity to FGF and RA signaling subdivides the HoxB genes in two distinct groups. Development 129(22), 51035115 (2002).
Article CAS PubMed Google Scholar
Shen, P. et al. Rapid induction and long-term self-renewal of neural crest-derived ectodermal chondrogenic cells from hPSCs. npj Regen. Med. 7(1), 115 (2022).
Article CAS Google Scholar
Xu, S. C., Harris, M. A., Rubenstein, J. L. R., Mundy, G. R. & Harris, S. E. Bone morphogenetic protein-2 (BMP-2) signaling to the Col21 gene in chondroblasts requires the homeobox gene Dlx-2. DNA Cell Biol. 20(6), 359365 (2001).
Article CAS PubMed Google Scholar
Lafont, J. E., Poujade, F. A., Pasdeloup, M., Neyret, P. & Mallein-Gerin, F. Hypoxia potentiates the BMP-2 driven COL2A1 stimulation in human articular chondrocytes via p38 MAPK. Osteoarthr. Cartil. 24(5), 856867 (2016).
Article CAS Google Scholar
Fernndez-Lloris, R. et al. Induction of the Sry-related factor SOX6 contributes to bone morphogenetic protein-2- induced chondroblastic differentiation of C3H10T1/2 cells. Mol. Endocrinol. 17(7), 13321343 (2003).
Article PubMed Google Scholar
Kim, H. S., Neugebauer, J., Mcknite, A., Tilak, A. & Christian, J. L. BMP7 functions predominantly as a heterodimer with BMP2 or BMP4 during mammalian embryogenesis. 122 (2019).
James, R. G. & Schultheiss, T. M. Bmp signaling promotes intermediate mesoderm gene expression in a dose-dependent, cell-autonomous and translation-dependent manner. Dev. Biol. 288(1), 113125 (2005).
Article CAS PubMed Google Scholar
Huang, D., Li, J., Hu, F., Xia, C., Weng, Q., Wang, T. et al. Lateral plate mesoderm cell-based organoid system for NK cell regeneration from human pluripotent stem cells. Cell Discov. 8(1) (2022).
Xi, H. et al. In vivo human somitogenesis guides somite development from hPSCs. Cell Rep. 18(6), 15731585 (2017).
Article CAS PubMed PubMed Central Google Scholar
Wu, C. L. et al. Single cell transcriptomic analysis of human pluripotent stem cell chondrogenesis. Nat. Commun. 12(1), 362 (2021).
Article CAS PubMed PubMed Central Google Scholar
Umeda, K. et al. Human chondrogenic paraxial mesoderm, directed specification and prospective isolation from pluripotent stem cells. Sci. Rep. 2(455), 111 (2012).
Google Scholar
Araoka, T., Mae, S. I., Kurose, Y., Uesugi, M., Ohta, A., Yamanaka, S. et al. Efficient and rapid induction of human iPSCs/ESCs into nephrogenic intermediate mesoderm using small molecule-based differentiation methods. PLoS One, 9(1), epub (114) (2014).
Zhang, P. et al. Short-term BMP-4 treatment initiates mesoderm induction in human embryonic stem cells. Blood 111(4), 19331941 (2008).
Article CAS PubMed Google Scholar
Winnier, G., Blessing, M., Labosky, P. A. & Hogan, B. L. M. Bone morphogenetic protein-4 is required for mesoderm formation and patterning in the mouse. Genes Dev. 9(17), 21052116 (1995).
Article CAS PubMed Google Scholar
Chalamalasetty, R. B. et al. Mesogenin 1 is a master regulator of paraxial presomitic mesoderm differentiation. Development 141(22), 42854297 (2014).
Article CAS PubMed PubMed Central Google Scholar
Chapman, D. L., Agulnik, I., Hancock, S., Silver, L. M. & Papaioannou, V. E. Tbx6, a mouse T-box gene implicated in paraxial mesoderm formation at gastrulation. Dev. Biol. 180(2), 534542 (1996).
Article CAS PubMed Google Scholar
Kashyap, V. & Gudas, L. J. Epigenetic regulatory mechanisms distinguish retinoic acid-mediated transcriptional responses in stem cells and fibroblasts. J. Biol. Chem. 285(19), 1453414548 (2010).
Article CAS PubMed PubMed Central Google Scholar
Cheng, A. et al. Cartilage repair using human embryonic stem cell-derived chondroprogenitors. Stem Cells Transl. Med. 3(11), 12871294 (2014).
Article CAS PubMed PubMed Central Google Scholar
Wang, L. et al. Activin/Smad2-induced histone H3 Lys-27 trimethylation (H3K27me3) reduction is crucial to initiate mesendoderm differentiation of human embryonic stem cells. J. Biol. Chem. 292(4), 13391350 (2017).
Article CAS PubMed Google Scholar
Fowler, D. A. & Larsson, H. C. E. The tissues and regulatory pattern of limb chondrogenesis. Dev. Biol. 463(2), 124134 (2020).
Article CAS PubMed Google Scholar
Waxman, J. S., Keegan, B. R., Roberts, R. W., Poss, K. D. & Yelon, D. Hoxb5b acts downstream of retinoic acid signaling in the forelimb field to restrict heart field potential in zebrafish. Dev. Cell 15(6), 923934 (2008).
Article CAS PubMed PubMed Central Google Scholar
Feneck, E. & Logan, M. The role of retinoic acid in establishing the early limb bud. Biomolecules 10(2) (2020).
Cunningham, T. J. & Duester, G. Mechanisms of retinoic acid signalling and its roles in organ and limb development. Nat. Rev. Mol. Cell Biol. 16(2), 110123 (2015).
Article CAS PubMed PubMed Central Google Scholar
Nishimoto, S., Wilde, S. M., Wood, S. & Logan, M. P. O. RA acts in a coherent feed-forward mechanism with Tbx5 to control limb bud induction and initiation. Cell Rep. 12(5), 879891 (2015).
Article CAS PubMed PubMed Central Google Scholar
Jepsen, K. et al. Combinatorial roles of the nuclear receptor corepressor in transcription and development. Cell 102(6), 753763 (2000).
Article CAS PubMed Google Scholar
Simeone, A., Acampora, D., Arcioni, L., Andrews, P. W., Boncinelli, E. & Mavilio, F. Sequential activation of HOX2 homeobox genes by retinoic acid in human embryonal carcinoma cells. Nat. 1990 3466286, 346(6286), 763766 (1990).
Kmita, M. & Duboule, D. Organizing axes in time and space; 25 years of colinear tinkering. Science (80-.) 301(5631), 331333 (2003).
Article CAS Google Scholar
Papalopulu, N., Lovel-badage, R. & Krumlauf, R. The expression of murine Hox-2 genes is dependent on the differentiation pathway and displays a collinear sensitivity to retinoic acid in F9 cells and Xenopus embryos. Nucleic Acids Res. 19(20), 5497 (1991).
Article CAS PubMed PubMed Central Google Scholar
De, K. B. et al. Analysis of dynamic changes in retinoid-induced transcription and epigenetic profiles of murine Hox clusters in ES cells. Genome Res. 25(8), 12291243 (2015).
An epigenetic barrier sets the timing of human neuronal maturation – Nature.com
PSC lines and cell culture
Experiments with hPSCs and iPSCss was approved in compliance with the Tri-Institutional ESCRO at Memorial Sloan Kettering Cancer Center, Rockefeller University and Weill Cornell Medicine. hPSC lines WA09 (H9; 46XX) and WA01 (H1; 46XY) were from WiCell Stemcell Bank. The GPI::Cas9 line was derived from WA09 hPSCs. MSK-SRF001 iPSCs were from Memorial Sloan Kettering Cancer Center. hPSCs and iPSCs were authenticated by STR. hPSCs and iPSCs were maintained with Essential 8 medium (Life Technologies A1517001) in feeder-free conditions onto vitronectin-coated dishes (VTN-N, Thermo Fisher A14700). hPSCs and iPSCs were passaged as clumps every 45 days with EDTA (0.5M EDTA/PBS) and routinely tested for mycoplasma contamination. The GPI::Cas9 knock-in hPSCline was generated using CRISPRCas9-mediated homologous recombination by transfecting H9 hPSCs with the Cas9-T2A-Puro targeting cassette downstream of the GPI gene (Supplementary Fig. 6b). Selected clones were validated by genomic PCR and Cas9 mRNA and protein expression by RTqPCR and western blot, respectively and screened for Karyotype banding. CHD5-KO and JADE2-KO WA09 hPSC lines were generated by the SKI Stem Cell Research Core at Memorial Sloan Kettering Cancer Center (MSKCC) via CRISPRCas9 using the following gRNA targets: CHD5, CGTGGACTACCTGTTCTCGG; JADE2, CAGTTTGGAGCATCTTGATG. Mouseepiblast stem cells (EpiSCs) B6.129_4 were a gift from the Vierbuchen laboratory at Memorial Sloan Kettering Cancer Center and were maintained on mouse embryonic fibroblasts as previously described64. Rat primary astrocytes were purchased from Lonza (R-CXAS-520) and cultured according to manufacturer instructions.
hPSCs (passage 4050) were differentiated toward cortical excitatory neurons using an optimized protocol based on dual SMAD inhibition and WNT inhibition as follows. hPSCss were dissociated at single cells using Accutase and plated at 300,000 cells per cm2 onto Matrigel-coated wells (354234, Corning) in Essential 8 medium supplemented with 10M Y-27632. On day 02, cells were fed daily by complete medium exchange with Essential 6 medium (E6, A1516401, Thermo Fisher Scientific) in the presence of 100nM LDN193189 (72142, Stem Cell Technologies), 10M SB431542 (1614, Tocris) and 2M XAV939 (3748, Tocris) to induce anterior neuroectodermal patterning. On day 39 cells were fed daily with Essential 6 medium (E6, A1516401, Thermo Fisher Scientific) in the presence of 100nM LDN193189 (72142, Stem Cell Technologies), 10M SB431542. On day 1020 cells were fed daily with N2/B27 medium (1:1 NB:DMEM/F12 basal medium supplemented with 1 N2 and B27 minus vitamin A) to generate a neurogenic population of cortical NPCs. N2 and B27 supplements were from Thermo. At day 20, NPCs were either cryopreserved in STEM-CELLBANKER solution (Amsbio) or induced for synchronized neurogenesis as following: NPCs were dissociated at single cells following 45min incubation with Accutase and seeded at 150,000 cells per cm2 onto poly-l-ornithine and laminin/ fibronectin-coated plates in NB/B27 medium (1 B27 minus vitamin A, 1% l-glutamine and 1% penicillin-streptomycin in Neurobasal medium) in the presence of 10M Notch pathway inhibitor DAPT for 10 days (until day30). For long-term culture, neurons were maintained in NB/B27 supplemented with BDNF (450-10, PreproTech), GDNF (248-BD-025, R&D biosystems), cAMP (D0627, Sigma) and ascorbic acid (4034-100, Sigma). From day 20 onwards, cells were fed every 45 daysby replacing 50%of the mediumvolume. For neurons-astrocytes co-cultures, rat primary astrocytes were plated onto poly-l-ornithine and laminin/fibronectin-coated plates in NB/B27 medium supplemented with BDNF, GDNF, cAMP and ascorbic acid and allowed to adhere for few days. hPSC-derived neurons at day 25 were dissociated using Accutase and seeded on top of rat astrocytes. Neurons-astrocytes co-cultures were maintained on NB/B27 medium supplemented with BDNF, GDNF, cAMP and ascorbic acid.
Mouse epiblast stem cells (mEpiSCs) B6.129_4 were differentiated as following: on day 0, mEpiSC colonies were lifted from feeders using 0.5Ul1 collagenase IV in HBSS++, dissociated to single-cell solution using Accutase, then plated at 220,000 cells per cm2 on Matrigel-coated wells in mN2/B27 media64 supplemented with 10M Y-27632, 100nM LDN193189, 10M SB431542 and 2M XAV939. Cells were fed daily with mN2/B27 supplemented with 2M XAV939 (day 1), 100nM LDN193189 (day 15), 10M SB431542 (day 15). On day 6 NPCs were dissociated to single-cell suspension using Accutase and replated at 200,000 cells per cm2 onto poly-l-ornithine and laminin/fibronectin-coated plates in NB/B27 medium (10% Neurobasal, 90% Neurobasal A, 1 B27 minus vitamin A, 1% Glutamax, 0.5% penicillin-streptomycin, 0.1% BDNF, 0.1% cAMP, 0.1% ascorbicacid, 0.1% GDNF) supplemented with 10M Y-27632 (day 6) and 10M DAPT (day 6 and 8). Cells were fed every other day by replacing 50% of the medium volume.
On day 1, WA09 (H9) hPSCs were dissociated with EDTA for 10min at 37C and allowed to aggregate into spheroids of 10,000 cells each in V-bottom 96 well microplates (S-Bio) in E8 medium with ROCK inhibitor (Y-27632, 10M) and WNT inhibitor (XAV939, 5M, Tocris 3748). The next day (day 0), the medium was changed to E6 supplemented 100nM LDN193189, 10M SB431542 and 5M XAV939. On day 5, medium was switched to E6 supplemented with 100nM LDN193189, 10M SB431542. On day 8, medium was changed to N2/B27-based organoid medium as previously described65. From day 0 to day 14 medium was replaced every other day. On day 14, organoids were transferred to an orbital shaker on 10cm dishes and half of the medium was changed on a MondayWednesdayFriday schedule. Treatment with 4M GSK343 or DMSO was performed transiently from day 1725 or day 1737 depending on the experiment as indicated in the figures.
For birth-dating experiments of WA09 (H9) hPSC-derived cortical neurons, 3M EdU (5-ethynyl-2-deoxyuridine, A10044 Invitrogen) was added to the culture for 48h in the following time windows: d1819, d2021, d2223, d2425, d2627, d2829. After treatment, EdU was washed out and neurons were fixed at day40 of differentiation and processed for immunostaining. Treatment of hPSC-derived cortical NPCs with small molecules inhibitors of chromatin regulator was performed from day12 to day20 of differentiation (Fig. 4b). Small molecules were washed out and withdrawn starting at day 20 before the induction of synchronized neurogenesis and neurons derived from all the treatments were maintained in the same conditions. Small molecules were dissolved in DMSO and added to the N2/B27 medium at 2 or 4 M depending on the experiment. DMSO in control conditions was added at the corresponding dilution factor as for epigenetic inhibitors.
Treatment of mEpiSC-derived NPCs was performed as follows: For Ezh2i experiments, 0.04% DMSO or 4M GSK343 was added to NPC medium on day 4 and 5. For Ezh2i+ experiments this treatment was extended with 0.02% DMSO or 2M GSK343 being added to medium on day 6, 8 and 10. GSK-J4 was used at 1 M and added to the medium on day 4 and 5.
The following small molecules targeting epigenetic factors were used in the study and purchased from MedChemExpress: GSK343 (HY-13500), UNC0638 (HY-15273), EPZ004777 (HY-15227), GSK2879552 (HY-18632), CPI-455 (HY-100421), A-196 (HY-100201), GSK-J4 (HY-15648F). A List of small molecules and relative molecular target is reported in Extended Data Fig. 3b.
For the morphological reconstruction of WA09 (H9) hPSC-derived neurons, NPCs were infected at day20 with low-titre lentiviruses expressing dTomato reporter. Following induction of neurogenesis, the resulting neurons were fixed at day 25, 50, 75 and 100. The dTomato reporter signal was amplified by immunofluorescence staining and individual neurons were imaged at Zeiss AXIO Observer 7 epi-fluorescence microscope at 10 magnification. Neuronal morphology was reconstructed in Imaris v9.9.1 software using the filamentTracer function in autopath mode and using the nucleus (using DAPI channel) as starting point. Traces were eventually manually corrected for accuracy of cell processes detection. Neurite length and Sholl Analysis (every 10 m radius) measurements were performed in the Imaris platform and extracted for quantifications and statistics. For staining with synaptic markers, cells were cultured on -plate 96 Well Black (Ibidi) and stained for SYN1 and PSD95 antibodies to visualize pre and post -synaptic puncta respectively and MAP2 to visualize neuronal dendrites. Confocal images were acquired using a 63 immersion objective at a Leica SP8WLL confocal laser-scanning microscope. Three fields of view for each sample from two independent differentiations (total of 6 fields of viewpercondition) were analysed as following. Single-plane confocal images were open in Fiji v2.9.0 and puncta were detected using the SynQuant plugin (https://github.com/yu-lab-vt/SynQuant). The z-score for particle detection was adjusted for accuracy of puncta detection. The other parameters were set as default value. Dendrite length was extracted from the reference MAP2 channel.
Cultured cells were fixed with 4% PFA in PBS for 20min at RT, washed three times with PBS, permeabilized for 30min in 0.5% Triton X-100 in PBS and then blocked in a solution containing 5% Normal goat serum or Normal donkey serum, 2% BSA and 0.25% Triton X-100 for 1h at room temperature. Primary antibodies were incubated overnight at 4Cin the same blockingsolution. EdU+ cells were detected using the Click-iT EdU Imaging kit (Molecular Probes) with Alexa Fluor 488 according to manufacturers instructions. Secondary antibodies conjugated to either Alexa 488, Alexa 555 or Alexa 647 (Thermo) were incubated for 45min at 1:400 dilutionin blocking solution. Cell nuclei were stained with 5M 4-6-diamidino-2-phenylindole (DAPI) in PBS.
Organoids were fixed in 4% PFA overnight at 4C, washed 3 times with PBS and cryoprotected in 30% sucrose/PBS. Organoid tissue was sectioned at 30m on a cryostat (Leica 3050S), mounted on microscope slides, allowed to dry at room temperature and stored at 80C. On the day of the staining, slides we defrosted for 20min at room temperature. Sections were first permeabilized in 0.5% Triton X-100 in PBS, blocked for 1h in 5% normal goat serum, 1% BSA, 0.25% triton in PBS and incubated in the same solution with primary antibodies overnight. The next day, sections were washed with PBS and incubated in secondary antibodies for 2.5h at room temperature at 1:400 dilution. DAPI 5M stain was used to identify cell nuclei. Images were captured using a Leica SP8WLL confocal laser-scanning microscope.
The following primary antibodies and dilutions were used: rabbit anti-PAX6 1:300 (901301, Biolegend); rabbit anti-FOXG1 1:500 (M227, Clonetech); mouse anti-Nestin 1:400 (M015012, Neuromics); mouse anti-MAP2 1:200 (M1406, Sigma); chicken anti-MAP2 1:2000 (ab5392, Abcam); rabbit anti-class III -tubulin (TUJI) 1:1,000 (MRB-435P, Covance); mouse anti-Ki67 1:200 (M7240, Dako); rabbit anti-Ki67 1:500 (RM-9106, Thermo Scientific); rabbit anti-TBR1 1:300 (ab183032, Abcam); rabbit anti-TBR1 1:500 (ab31940, Abcam); rat anti-CTIP2 1:500 (ab18465, Abcam); mouse anti-SATB2 1:1,000 (ab51502, Abcam); rabbit anti-synapsin I 1:1,000 (S193, Sigma); mouse anti-PSD95 1:500 (MA1-046, Thermo); mouse anti-neurofilament H 1:500 (non-phosphorylated) (SMI32, Enzo Life science); mouse anti c-FOS 1:500 (ab208942, Abcam); mouse anti-HLA Class I ABC 1:150 (ab70328, abcam); goat anti-RFP 1:1,000 (200-101-379, Rockland); rabbit anti-DsRed 1:750 (632496, Clontech); rabbit anti-H3K27me3 1:200 (9733, Cell Signaling Technologies); rabbit anti-GFAP 1:500 (Z033429-2, Dako); chicken anti-GFP 1:1,000 (ab13970, Abcam); rat anti-SOX2 1:200 (14-9811-82, Thermo); rabbit anti-AQP4 1:500 (HPA014784, SIGMA); sheep anti-EOMES 1:200 (AF6166, R&D). The primary antibodies including anti-GFAP antibody were validated for recognition of human antigens to confirm lack of human astrocytes in our synchronized cortical cultures.
smRNA-FISH was performed on WA09 (H9) hPSC-derived and mEpiSC-derived neurons using ViewRNA Cell Plus Assay Kit (Invitrogen) in RNAse-free conditions according to manufacturers instructions to simultaneously detect RNA targets by in situ hybridization and the neuronal marker MAP2 (Alexa Fluor 647) by immunolabelling. Neurons were plated on -plate 24 Well Black (Ibidi) plates, fixed and permeabilized for 15min at room temperature with fixation/permeabilization solution and blocked for 20min followed by incubation with primary and secondary antibody for 1h at room temperature. Target probe hybridization with mouse or human -specific viewRNA Cell Plus probe sets was carried at 40C under gentle agitation for 2h. Type 1 (Alexa Fluor 546) and type 4 (Alexa Fluor 488) probe sets were used to detect EZH2 and TBP RNA respectively, using the same fluorophore scheme for neurons derivedfrom mEpiSCs and hPSCs. Pre amplification, amplification and fluorescence labelling steps were carried at 40C under gentle agitation for 1h each. Washes were performed as indicated in the kits procedure. Samples were incubated with 5M DAPI to visualize cell nuclei and a coverslip was gently placed inside each well using ProLong Glass Antifade Mountant. z-stack images at 0.4 m step and covering the entire cell volume were acquired using a Leica SP8WLL confocal laser-scanning microscope with a 63 immersion objective at 3 digital zoom. z-stacks were loaded and projected in Imaris v9.9.1 software for RNA puncta visualization and quantification within each single MAP2 positive neuron. Eight different fields of view (25 neurons per field) for each condition (mouse versus human) from two independent batches of differentiations (16 fields of view per condition) were obtained for downstream analysis. The nuclear volume for each neuron was reconstructed and calculated using the Surface function in Imaris Software.
For electrophysiological recordings, neurons were plated in 35mm dishes. Whole-cell patch clamp recordings during the maturation time course were performed at day 25, 50, 75 and 100 of differentiation as previously described22. In brief, neurons were visualized using a Zeiss microscope (Axioscope) fitted with 4 objective and 40 water-immersion objectives. Recordings were performed at 2324C and neurons were perfused with freshly prepared artificial cerebral-spinal fluid (aCSF) extracellular solution saturated with 95% O2, 5% CO2 that contained (in mM): 126 NaCl, 26 NaHCO3, 3.6 KCl, 1.2 NaH2PO4, 1.5 MgCl2, 2.5 CaCl2, and 10 glucose. Pipette solution for recordings in current clamp configuration contained (in mM): 136 KCl, 5 NaCl, 5 HEPES, 0.5 EGTA, 3 Mg-ATP, 0.2 Na-GTP, and 10 Na2-phosphocreatine, pH adjusted to 7.3 with KOH, with an osmolarity of ~290mOsm. For mEPSCs, the pipette solution contained (in mM): 140 CsCl, 10 NaCl, 10 HEPES, 0.5 EGTA, 3 Mg-ATP, 0.2 Na-GTP, and 10 Na2-phosphocreatine, pH adjusted to 7.3 with CsOH. 20M ()-bicuculline methochloride (Tocris), 1M strychnine HCl (Sigma), and 0.5M tetrodotoxin (TTX) (Alomone Labs) were added to aCSF for mEPSC recordings to block GABAA receptors, glycine receptors, and voltage-gated Na+ channels, respectively. Input resistance was measured from a voltage response elicited by intracellular injection of a current pulse (100 pA, 200ms). Membrane voltage was low-pass filtered at 5kHz and digitized at 10kHz using a Multiclamp 700B amplifier connected to a DigiData 1322A interface (Axon Instruments) using Clampex 10.2 software (Molecular Devices). Liquid junction potentials were calculated and corrected off-line. Action potentials were generated in current clamp from currents injected in 10 pA intervals from 0 to 250 pA. Recordings were analysed for: resting membrane potential, input resistance, rheobase, threshold, as well as action potential amplitude, overshoot, duration, half-width, rise and decay. Neurons were held at 80mV and continuous recordings of mEPSCs were made using Axoscope software (Molecular Devices). Data processing and analysis were performed using MiniAnalysis (Synaptosoft) version 6 and Clampfit 10.2 (Molecular Devices). Events were detected by setting the threshold value, followed by visual confirmation of mEPSC detection. Whole-cell patch clamp recordings in neurons derived from DMSO and EZH2i conditions (pipettes 36 M) were performed in aCSF containing (in mM): 125 NaCl, 2.5 KCl, 1.2 NaH2PO4, 1 MgSO4, 2 CaCl2, 25 NaHCO3 and 10 d-glucose. pH and osmolarity were adjusted to 7.4 and 300310mOsm, respectively. For firing recordings, pipettes were filled with a solution containing (in mM): 130 potassium gluconate, 4 KCl, 0.3 EGTA, 10 Na2-phosphocreatine, 10 HEPES, 4 Mg2-ATP, 0.3 Na2-GTP and 13 biocytin. pH and osmolarity were adjusted to 7.3 (with KOH) and 285290mOsm respectively. For mEPSCs recordings the ACSF was supplemented with 1M TTX and 100M 4-AP and pipettes were filled with a caesium-based solution that contained (in mM): 120 CsMeSO4, 8 NaCl, 10 HEPES, 0.3 EGTA, 10 TEA-Cl, 2 Mg2-ATP, 0.3 Na2-GTP, 13.4 biocytin and 3 QX-314-Cl. pH: 7.3 (adjusted with CsOH) and 290295mOsm. Recordings were acquired with a computer-controlled Multiclamp 700B amplifier and a Digidata 1550B (Molecular Devices, California) at a sampling rate of 10kHz and low-pass filtered at 1kHz. pClamp 10 software suite (Molecular Devices) was used for data acquisition (Clampex 10.6) and data analysis (Clampfit 10.6). The quantification of the amplitude and inter-event interval of mEPSCs shown in the cumulative probability plots in Fig. 4j was performed taking all the events together. To isolate the NMDA component from mEPSCs recorded at +40mV, we measured current amplitude 20ms after the mEPSC onset, where AMPA receptors are desensitized (depicted by the dotted line in Extended Data Fig. 5f)66,67,68. For the calculation of the NMDA/AMPA ratio, the amplitude of the NMDA component was then divided by the amplitude of the peak of the AMPA currents recorded at 70mV. Statistical analysis and plots were done in Prism 9 (GraphPad, California). Evoked action potential and traces shown in DMSO versus EZH2i groups in Fig. 4g were elicited with 20 pA injected current.
hPSC-derived cortical neurons were infected with lentiviruses encoding GCaMP6m and cultured on -plate 96 Well Black (Ibidi). In rat astrocytes co-culture experiments, hPSC-derived neurons were infected with GCaMP6m lentiviruses four days before dissociation and prior to seeding onto rat primary astrocytes. For each batch of experiments, the infection and measurement of Ca2+ spikes in neurons under control or genetic/pharmacological perturbation has been done in parallel on the same day to account for the variability in the absolute expression of GCaMP6m due to lentiviral delivery. Ca2+ imaging was performed as previously described69. In brief, on the day of the imaging, cells were gently washed twice in modified Tyrode solution (25mM HEPES (Invitrogen), 140mM NaCl, 5mM KCl, 1mM MgCl2, 10mM glucose, 2mM CaCl2, 10M glycine, 0.1% BSA pH 7.4, pre-warmed to 37C) and equilibrated in imaging buffer for 1-2min (25mM HEPES, 140mM NaCl, 8mM KCl, 1mM MgCl2, 10mM glucose, 4mM CaCl2, 10M glycine, 0.1% BSA pH 7.4, pre-warmed to 37C). GCaMP6m fluorescence was recorded on Celldiscover7 (ZEISS) inverted epi-fluorescence microscope with the 488nm filter under environmental control (37C; 95% O2, 5% CO2) using ZEN Blue 3.1 software at the Bio-Imaging Resource Center (BIRC) at Rockefeller University. Neuronal cultures were imaged for ~3min at a frame rate of 46 frames per second (600800 frames per time lapse) using a 10 or 20 objective.
hPSC-derived cortical brain organoids were infected with lentiviruses encoding GCaMP6m at day 45 of differentiation and cultured in BrainPhys Imaging Optimized Medium (Stem Cell Technologies) for a week before the imaging. On the day of the imaging, DMSO control and organoids transiently treated with GSK343 were equilibrated in imaging buffer for 30min and transferred into imaging cuvettes. GCaMP6m fluorescence on intact organoids was recorded by light-sheet microscopy on TruLive3D Imager (Bruker) under environmental control (37C; 95% O2 5% CO2). Multiple fields of view from 34 organoids per condition from 2 independent batches each were imaged for ~24min at a frame rate of 510 frames per second at 31.3 effective magnification.
Analysis was performed as previously described69. In brief, the live-imaging image stack was converted to TIFF format and loaded into optimized scripts in MATLAB (Mathworks) R2020b and R2021b. Region of Interest (ROI) were placed on the neuron somas to calculate the raw GCaMP6m intensity of each neuron over time. The signal intensity of each raw trace was normalized to baseline fluorescence levels (F/F0) for spike detection. Single-neuron amplitude was calculated from the normalized GCaMp6m intensity for all the detected spikes in each trace (mean F/F0 of detected spikes for each neuron). Single-neuron frequency was calculated as the number of detected spikes in each trace per minute of recording. Network activity was assessed by calculating the synchronous firing rate, defined as the number of detected synchronous Ca2+ spikes from all ROI in one FOV per minute of recording. In Figs. 1k and 4k, coloured lines depict the normalized (F/F0) GCaMP6m signal traces of individual neurons in 1 field of view during 1min of imaging; the black line is the averaged normalized GCaMP6m signal among neurons in 1 field of view. Images in Figs. 1j Fig. 4m were displayed as royal lookup table in FIJI. Supplementary Videos16 show 20 frames per second, Supplementary Videos7 and 8 show 100 frames per second.
Microscopy images were visualized with Adobe Photoshop 2022, Fiji 2.9.0 or Imaris software version 9.9.1. Morphological reconstruction of neurons was performed using Imaris software version 9.9.1. Ca2+ imaging analysis was performed using MATLAB software. Quantification of immunofluorescence images was performed in FIJI (ImageJ) version 2.9.0 or using the Operetta high content imaging system coupled with Harmony software version 4.1 (PerkinElmer).
Cells were collected and lysed in RIPA buffer (Sigma) with 1:100 Halt Protease and Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific) and then sonicated for 330sec at 4C. Protein lysates were centrifugated for 15min at more than 15,000rpm at 4C and supernatant was collected and quantified by Precision Red Advanced Protein Assay (Cytoskeleton). 510g of protein were boiled in NuPAGE LDS sample buffer (Invitrogen) at 95C for 5min and separated using NuPAGE 412% Bis-Tris Protein Gel (Invitrogen) in NuPAGE MES SDS Running Buffer (Invitrogen). Proteins were electrophoretically transferred to nitrocellulose membranes (Thermo Fisher Scientific) with NuPAGE Transfer Buffer (Invitrogen). Blots were blocked for 60min at room temperature in TBS-T+5% nonfat milk (Cell Signaling) and incubated overnight in the same solution with the respective primary antibodies at 4C. The following primary antibodies were used: mouse anti-neurofilament H 1:500 (non-phosphorylated) (SMI32; Enzo Life science); mouse anti-syntaxin 1A 1:500 (110 111; SYSY); mouse anti-actin 1:500 (MAB1501; Millipore); mouse anti-Cas9 1:500 (14697; Cell Signaling Technology); rabbit anti-CHD3 1:1,000 (ab109195, Abcam); rabbit anti-KDM5B 1:1,000 (ab181089, abcam). The following secondary antibodies were incubated for 1h at room temperature at 1:1,000 dilution: anti-mouse IgG HRP-linked (7076; Cell Signaling Technology) and anti-rabbit IgG HRP-linked (7074; Cell Signaling Technology). Blots were revealed using SuperSignalTM West Femto Chemiluminescent Substrate (Thermo Fischer Scientific) at ChemiDoc XRS+ system (Bio-Rad). Chemiluminescence was imaged and analysed using Image lab software version 6.1.0 (Bio-Rad). Controls samples were run within each gel and the signal intensity of protein bands of interest was normalized to the intensity of the actin band (loading control) for each sample on the same blot. Uncropped and unprocessed images are shown in Supplementary Figure 1. One sample t-test on Fig. 3d was performed by comparing the mean of logFC for each genetic perturbation with the hypothetical mean logFC = 0 (null hypothesis of no changes). Two-tailed ratio-paired t-test in Fig. 4c was calculated on normalized marker/actin expression in manipulations versus DMSO.
Samples were collected in Trizol. Total RNA from hPSC-derived samples was isolated by chloroform phase separation using Phase Lock Gel-Heavy tubes, precipitated with ethanol, and purified using RNeasy Mini Kit (Qiagen) with on-column DNA digestion step. RNA from mouse cells was isolated using Direct-zol microprep kit (Zymo research, R2060). cDNA was generated using the iScript Reverse Transcription Supermix (Bio-Rad) for RTqPCR and quantitative PCR (qPCR) reactions were performed using SsoFast EvaGreen Supermix (Bio-Rad) according to the manufacturers instructions in 96 or 384-well qPCR plates using CFX96 and CFX384 Real-Time PCR Detection systems (Bio-Rad) using 510ng cDNA / reaction. Primers were from Quantitect Primer assays (QUIAGEN) except for the ones in Supplementary Table 4. Results were normalized to the housekeeping genes GAPDH or TBP.
A Cas9-T2A-PuroR cassette flanked by 5 and 3 homology arms for the GPI locus was generated by NEBuilder HiFi DNA Assembly Cloning Kit of PCR-amplified fragments according to manufacturers instruction. EF1alpha-GCaMP6m lentiviral vector was generated by PCR amplification of GCaMP6m from pGP-CMV-GCaMP6m (Addgene 40754) using with Q5 High Fidelity master mix (NEB) and subcloned into pWPXLd (Addgene 12258) into BamH1 and EcoRI restriction site using standard cloning methods. For the simultaneous expression of gene-specific gRNA under transcriptional control of U6 promoter and dTomato fluorescent reporter driven by EF1alpha promoter, the SGL40.EFs.dTomato vector (Addgene 89398) was modified by inserting a P2A-Basticidin cassette downstream of dTomato sequence to generate the SGL40.EFs.dTomato-Blast backbone. gRNA sequences specific to each gene were designed using SYNTEGO CRISPR design tool (https://www.synthego.com/products/bioinformatics/crispr-design-tool) and validated using CRISPOR tool70 (http://crispor.tefor.net). DNA oligos (IDT) were annealed and subcloned into BsmBI restriction sites of SGL40.EFs.dTomato-Blast lentiviral backbone by standard cloning methods. Lentiviruses were produced by transfection of HEK293T cells (ATCC) using the Xtreme Gene 9 DNA transfection reagent (Sigma) with the respective lentiviral vectors along with the packaging vectors psPAX2 (Addgene, 12260) and pMD2.G (Addgene, 12259). Arrayed CRISPR gRNA lentiviral libraries were produced simultaneously. Viruses were collected 48h post transfection, filtered with 0.22-m filters and stored in aliquots at 80C.The sequence of each gRNA used is reported in Supplementary Table 5.
Total RNA was extracted as described above. Sample for RNA-seq during chronological maturation at hPSC, NPC, d25, d50, d75 and d100 timepoints were submitted for TruSeq stranded ribo-depleted paired-end total RNA-seq at 4050 million reads at the Epigenomic Core at Well Cornell Medical College (WCMC). Samples for RNA-seq studies on neurons upon perturbation with epigenetic inhibitors were submitted for paired-end poly-A enriched RNA-seq at 2030 million reads to the MSKCC Integrated Genomic Core. Quality control of sequenced reads was performed by FastQC. Adapter-trimmed reads were mapped to the hg19 human genome using versions 2.5.0 or 2.7.10b of STAR71. The htseq-count function of the HTSeq Python package version 0.7.172 was used to count uniquely aligned reads at all exons of a gene. For the chronological maturation studies, the count values were transformed to RPKM to make them comparable across replicates. A threshold of 1 RPKM was used to consider a gene to be present in a sample and genes that were present in at least one sample were used for subsequent analyses. Differential gene expression across timepoints or treatments with epigenetic inhibitors was computed using versions 1.16 or 1.22.2 of DESeq2 respectively73. Variance stabilizing transformation of RNA-seq counts was used for the PCA plots and for heat maps of gene expression. For downstream analysis of trends of gene expression, transcripts were first grouped into monotonically upregulated and monotonically downregulated based on the characteristics of their expression from d25 to d100 and further categorized in strict: all the transitions satisfy the statistical significance criteria and relaxed: d25 versus d100 transition satisfy the significance criteria and intermediate transitions may not. For all comparisons a significance threshold of false discovery rate (FDR)5% was used. Monotonically upregulated (strict): (d50 versus d25: FDR5%) and (d100 versus d25: FDR5%) and (d100 versus d50: FDR5%) and (d50 versus d25:logFC > 0) and (d75 versus d50: logFC > 0) and (d100 versus d25 logFC > d50 versus d25 logFC). Monotonically downregulated (strict): (d50 versus d25:FDR5%) and (d100 versus d25: FDR5%) and (d100 versus d50: FDR5%) and (d50 versus d25:logFC <0) and (d75 versus d50: logFC <0) and (d100 versus d25 logFC
The score for maturation in neurons upon epigenetic inhibition and control conditions (Extended Data Fig. 7b,c). was computed based on the geometric distribution of samples in the three-dimensional coordinate system defined by PCA1, 2 and 3. For each condition (treatment and day of differentiation), the coordinates defining the position of the samples in the 3D PCA space were determined based on the average across replicates. The DMSO d25 coordinates were set as the origin. The vectors defining maturation trajectories for each treatment and timepoint were then measured as the connecting segments between sample coordinates. The vector linking DMSO d25 and DMSO d50 conditions was used to define the chronological maturation trajectory and set as a reference (control vector) to calculate a similarity score for each treatment at any given timepoint. To account for vector magnitude and directionality, the dot product metric treatment vectorcontrol vector was used to calculate the scores. Gene expression correlation heat maps in Extended Data Fig7d were created from either all genes or maturation genes only by computing Pearson correlation and then running agglomerative hierarchical clustering using complete linkage. k-Means clustering in Extended Data Fig7e was performed on z-score converted normalized counts and run using the kmeans function in R with nstart = 25 and k=2:10, stopping when clusters became redundant (k=4).
ATAC-seq libraries were prepared at the Epigenetic Innovation Lab at MSKCC starting from ~50,000 live adherent cells plated on 96-wells. Size-selected libraries were submitted to the MSKCC Genomic core for paired-end sequencing at 4060 million reads. Quality control of sequenced reads was performed by FastQC (version 0.11.3) and adapter filtration was performed by Trimmomatic version 0.36. The filtered reads were aligned to the hg19 reference genome. Macs2 (version 2.1.0)77 was used for removing duplicate reads and calling peaks. Differentially accessible peaks in the atlas were called by DESeq2 version 1.1673. To define dynamic trends of chromatin accessibility during neuronal maturation as shown in Fig. 3g, agglomerative hierarchical clustering using Wards linkage method was done on the union of differentially accessible peaks in pairwise comparisons between d25, d50, d75 and d100 samples. HOMER findMotifsGenome.pl (version 4.6)78 was used to investigate the motif enrichment in pairwise comparisons and unbiasedly clustered groups of peaks. Motif enrichment was also assessed by KolmogorovSmirnov and hypergeometric tests as previously described79. ATAC-seq peaks in the atlas were associated with transcription factor motifs in the updated CIS-BP database80,81 using FIMO82 of MEME suite version 4.1183. Hypergeometric test was used to compare the proportion of peaks containing a transcription factor motif in each group (foreground ratio) with that in the entire atlas (background ratio). Odds ratio represents the normalized enrichment of peaks associated with transcription factor motifs in the group compared to the background (foreground ratio/background ratio). Odds ratio1.2 and transcription factor expression from parallel RNA-seq studies (reaching1 RPKM) in neurons at any timepoint (d25, d50, d75, d100) was used to filter enriched transcription factor motif.
CUT&RUN was performed from 50,000 cells per condition as previously described84 using the following antibodies at 1:100 dilution: rabbit anti-H3K4me3 (aab8580, abcam); rabbit anti-H3K9me3 (ab8898, abcam); rabbit anti-H3K27me3 (9733, Cell Signaling Technologies); rabbit anti-H3K27ac (309034, Active Motif), normal rabbit IgG (2729, Cell Signaling Technologies). In brief, cells were collected and bound to concanavalin A-coated magnetic beads after an 8min incubation at room temperature on a rotator. Cell membranes were permeabilized with digitonin and the different antibodies were incubated overnight at 4C on a rotator. Beads were washed and incubated with pA-MN. Ca2+-induced digestion occurred on ice for 30min and stopped by chelation. DNA was finally isolated using an extraction method with phenol and chloroform as previously described84. Library preparation and sequencing was performed atthe MSKCC Integrated Genomic Core.
Sequencing reads were trimmed and filtered for quality and adapter content using version 0.4.5 of TrimGalore (https://www.bioinformatics.babraham.ac.uk/projects/trim_galore) and running version 1.15 of cutadapt and version 0.11.5 of FastQC. Reads were aligned to human assembly hg19 with version 2.3.4.1 of bowtie2 (http://bowtie-bio.sourceforge.net/bowtie2/index.shtml) and MarkDuplicates of Picard Tools version 2.16.0 was used for deduplication. Enriched regions were discovered using MACS2 with a p-value setting of 0.001 and a matched IgG or no antibody as the control. The BEDTools suite version 2.29.2 (http://bedtools.readthedocs.io) was used to create normalized read density profiles. A global peak atlas was created by first removing blacklisted regions (https://www.encodeproject.org/annotations/ENCSR636HFF) then merging all peaks within 500bp and counting reads with version 1.6.1 of featureCounts (http://subread.sourceforge.net). Reads were normalized by sequencing depth (to 10 million mapped fragments) and DESeq2 (v1.22.2) was used to calculate differential enrichment for all pairwise contrasts. Clustering was performed on the superset of differential peaks using k-means clustering by increasing k until redundant clusters arose. Gene annotations were created by assigning all intragenic peaks to that gene, and otherwise using linear genomic distance to transcription start site. The annotations in each cluster were used to intersect with the RNA-seq time series by plotting the average expression z-score of all peak-associated genes which are differentially expressed across any stage. Motif signatures and enriched pathways were obtained using Homer v4.11 (http://homer.ucsd.edu). Tracks of CUT&RUN peaks were visualized in Integrative Genomics Viewer version 2.8.9 (IGV, Broad Institute).
Neuronal cultures at day 27 of differentiation were washed three times in PBS, incubated with Accutase supplemented with Neuron Isolation Enzyme for Pierce (Thermo 88285) solution at 1:50 at 37C for 4560min and gently dissociated to single-cell suspensions via pipetting. After washing in PBS, single-cell suspensions were diluted to 1,000 cells per l in 1 PBS with 0.04% BSA and 0.2Ul1 Ribolock RNAse inhibitor (Thermo EO0382) for sequencing. scRNA-seq was performed at the MSKCC Integrated Genomic Core for a target recovery of 10,000 cells per sample using 10X Genomics Chromium Single Cell 3 Kit, version 3 according to the manufacturers protocol. Libraries were sequenced on an Illumina NovaSeq. The CellRanger pipeline (Version 6.1.2) was used to demultiplex and align reads to the GRCh38 reference genome to generate a cell-by-gene count matrix. Data analysis was performed with R v4.1 using Seurat v4.2.085. Cells expressing between 200 and 5,000 genes and less than 10% counts in mitochondrial genes were kept for analysis. Gene counts were normalized by total counts per cell and ScaleData was used to regress out cell cycle gene expression variance as determined by the CellCycleScoring function. PCA was performed on scaled data for the top 2,000 highly variable genes and a JackStraw significance test and ElbowPlot were used to determine the number of principal components for use in downstream analysis. A uniform manifold approximation and projection (UMAP) on the top 12 principal components was used for dimensional reduction and data visualization. FindNeighbors on the top 12 principal components and FindClusters with a resolution of 0.3 were used to identify clusters. Published scRNA-seq datasets for hPSC cortical differentiation were from Yao et al.86 (PMID: 28094016) and Volpato et al.87 (PMID: 30245212). To compare our dataset to those generated by Yao et al.86 and Volpato et al.87, Seurats anchor-based integration approach85 was used using FindIntegrationAnchors with 5,000 features. Single-cell hierarchical clustering and plotting for Extended Data Fig. 1h was performed with HGC88 using the Louvain algorithm. Single-cell RNA-seq analysis for mouse cortical development in Fig. 3f,g were from the published dataset from Di Bella et al.41 Data were processed using the same pipeline as in the original publication and developmental trajectories were inferred using v1.1.1.URD algorithm89.
Sample sizes were estimated based on previous publications in the field. Investigators were not blinded to experimental conditions. However, for knockout and small molecule treatment studies, samples were de-identified respect to the molecular target. Transcriptional and genomic studies were performed with the same bioinformatic pipeline between conditions.Statistics and data representation were performed in PRISM (GraphPad) version 8,9 or 10, excel and R software version 3.5.2 or 4.1. Statistical tests used for each analysis are indicated in the figures legend. Data are represented as arithmetical means.e.m. unless otherwise indicated.
Independent replication from representative micrographs were as following. Fig. 1b, 6 experiments; Fig. 1j, 3 experiments; Fig. 1n, 2 experiments, Fig. 2d, 2 experiments; Fig. 3c, 2 experiments for each genetic perturbation; Fig. 4m, 4 experiments; Supplementary Fig. 2a, 4 experiments; Supplementary Fig. 2f, 3 experiments; Supplementary Fig. 6e, 1 experiment; Extended Data Figs. 6a, 2 experiments; Extended Data Figs. 6c, 2 experiments; Supplementary Fig. 8e, 2 experiments for d12 and d16.
Further information on research design is available in theNature Portfolio Reporting Summary linked to this article.
Continue reading here:
An epigenetic barrier sets the timing of human neuronal maturation - Nature.com
Stem Cell Transplant and CAR T-cell Therapy: The Patient and Care Partner Experience | BMT Infonet – BMT Infonet |
How to Support theUnique Psychosocial Challenges of Stem Cell Transplantand CAR T-cell Therapy Patients and Their Care Partners Mental Health Professionals: Earn 7 continuing education credits Why Take this Course? "I learned, as a transplant recipient, that a therapist is not a therapist is not a therapist. Working with a therapist who understands stem cell transplant is a completely different animal than working with an excellent therapist who doesnt have that knowledge base. I didnt have to explain the transplant experience. We could hit the ground running with our therapy. Nancy, stem cell transplant recipient.
Hematopoietic stem cell transplantation (HCT), also calledbone marrow, stem cell and cord blood transplantation, andCAR T-cell therapy, are two intensive therapies used to treat patients with advanced hematologic malignancies and certain genetic/immune system disorders. The intensity of the treatment, compared to standard chemotherapy for cancer patients, generates a unique set of medical and psychosocial consequences that are critical for mental health professionals (MHPs) to understand in order to most effectively support and treat these patients and their care partners.
This course is intended for psychologists, social workers, mental health counselors, and therapists. The instructional level isintermediate. We assume that participants already have psycho-oncology educational background and experience.
The primary format is a non-interactive distance-learning continuing education course presented through a series of videos.
Module 1: The Nuts and Bolts of Hematopoietic Cell Transplantation (HCT)John Wingard, MD; Michelle Bishop, PhD;Justin Regan, RN A broad overview of HCT including the rationale for its use; eligible patients; short-term, long-term, and late effects of treatment; and the impact on patients and care partners overall quality of life (QOL) and health behaviors.Includes an in-depth review of the psychosocial issues experienced by HCT patients and care partnersand concludes with a brief presentation by an HCT patient discussing the challenges both he and his family faced while undergoing and surviving two stem cell transplants.
Module 2: Autologous HCT: A Deeper Dive R. Gregory Bociek MD, MSc An in-depth review of the medical processes and the short- and long-term consequences of undergoing an autologous HCT. Autologous HCT is a transplant that uses the patients own stem cells. It is a treatment option for some patients diagnosed with multiple myeloma, non-Hodgkin lymphoma, Hodgkin disease and some solid tumors.
Module 3: Allogeneic HCT: A Deeper Dive Minoo Battiwalla MD, MS An in-depth review of the medical processes and the short-and long-term consequences of undergoing an allogeneic HCT. Allogeneic HCT uses stem cells provided by a donor, rather thanthe patient. It is a treatment option forsome patients diagnosed with leukemia, myelodysplastic syndrome, a myeloproliferative disorder, severe aplastic anemia, or an inherited disorder such as sickle cell disease.
Module 4: Unique Psychosocial Challenges for Autologous and Allogeneic HCT Patients and Care PartnersElizabeth M. Muenks, PhD A comparison of the psychosocial issues experienced by autologous HCT patients,allogeneic HCT patients, and their care partners during preparation for HCT, the day of transplant and early recovery, the first 100 days after HCT, and long-term.
Module 5: Graft-versus-Host Disease (GVHD): Trading an Acute Disease for a Chronic Disease Amin M. Alousi, MD;Michelle Bishop, PhD An overview of GVHD, a major complication that affects approximately 50%of patients who undergo an allogeneic HCT.This module includes an in-depth discussion of how GVHD affects multiple organs and tissues, treatment options and their potential side effects, and the psychosocial consequences of livingwith GVHD in the short- and long-term for both patients and care partners.
Module 6: Psychiatric Disorders in Patients Undergoing HCTMaria Adelaida Rueda-Lara, MD A review of common psychiatric issues that occur during and after HCT, and their management.
Module 7: CAR T-cell Therapy: The Medical and Psychosocial Experience Areej El-Jawahri, MD An in-depth review of the medical and psychosocial consequences of CAR T-cell therapy - a treatment option for some patients with non-Hodgkin lymphoma, acute lymphoblastic leukemia, and multiple myeloma.
At the conclusion of this course, participants will be able to:
Describe the rational for using HCT to treat patients with hematological disorders and certain genetic/immune system disorders, and the psychosocial issues associated with treatment in the short-and long-term.
Describe the steps involved in autologous HCT,andthe short- and long-term medical side effectsand psychosocial issues.
Describe the steps involved in an allogeneic HCT,and the short- and long-term medical side effects and psychosocial issues.
Describe how psychosocial issues associated with autologous HCT compareto those associated with an allogeneic HCT for both patients and care partners.
Explain what graft-versus-host disease (GVHD) is, differentiate acute vs chronic GVHD, describe the unique medical and psychosocial challenges that GHVD patients and care partnersexperience, and discuss psychotherapeutic treatment modalities to address those challenges.
Describe the incidence of and risk factors associated with common psychiatric disorders thatoccur during each phase of the HCT process and identify the psychiatric sequelae of common medications used to treat patients during HCT.
Describe the types of hematological disorders most frequently treated with CAR T-cell therapy and the unique stressors and medical and psychosocial sequelae that come with this treatment.
Describepsychological and psychiatric treatment modalities that have proven beneficial for these patient populations.
Amin M. Alousi MD
Professor of Medicine,Medical Director of theStem Cell Transplant and Cellular Therapy ProgramandDirector of the Multi-Discipline GVHD Clinic and Research Program,MD Anderson Cancer Center
Minoo Battiwalla, MD, MS
Director of Blood Cancer Outcomes Research,Sarah Cannon Transplant and Cellular Therapy Network
Michelle Bishop, PhD
Coping with Cancer & Caregiving, LLC Co-Director of Mental Health Projects andGVHD Support Group Program Lead, BMT InfoNet
R. Gregory Bociek, MD, MSc
Associate Professor, Oncology & Hematology,University of Nebraska Medical Center
Areej E-Jawahri, MD
Associate Professor of Medicine andDirector of the Bone Marrow Transplant Survivorship Program,Massachusetts General Hospital
Elizabeth M. Muenks, PhD
Assistant Professor,Psychiatry and Behavioral Sciences, andDirector of Psychology Services, University of Kansas Medical Center
Justin Regan, RN
Recipient of two allogeneic stem cell transplants
Maria Adelaida Rueda-Lara, MD
Assistant Professor, Department of Psychiatry & Behavioral Sciences andMedical Director of Psycho-Oncology,University of Miami Miller School of Medicine
John Wingard, MD
Professor of Medicine, Retired Deputy Director of theUF Health Cancer Center andDirector of the Bone Marrow Transplant Program,University of Florida Health Cancer Center
ENROLL in this course consisting of seven modules.Course fee - $199.(includes all seven modules)
COMPLETE COURSE CONTENT by finishing all modules.
TAKE THE POST-TEST assessment and achieve a passing grade of at least 75%
Complete the COURSE EVALUATION
Full attendance is required for all CE activities. This means you will be asked to certify that you watched all the videos included in this course.Once you have completed the above steps, your course certificate will automatically populate for download. It can be downloaded immediately, emailed, and will be available for future download.
Click to Enroll Now
There was no commercial support provided for this CE program, the content, or to the instructor(s).
It is absolutely critical that our program exemplifies accessibility for all participants. We seek to ensure all participants are able to fully, equally, and independently access the educational content. Our goal is to have a website that is perceivable, operable, understandable, and robust. If you have any difficulty navigating the website, we want to know! Please contact us atinfo@findempathy.com.
CE credits require a post-test assessment. The assessment is untimed and provided in writing on the course website. However, for individuals with visual impairments, or those that may benefit from an orally presented post-test and program evaluation, contact us. We will work with you to find an alternative option for completing the course post-test and program evaluation.We remain available and open to ANY additional requests for format modification or additional assistance.
If any accommodations are needed to enroll or participate in the course, or complete the post-test and course evaluation, please contact us atinfo@findempathy.com.
Course Access::Once enrolled in a course, you have 30 days to complete the post-test and course evaluation. If your access lapses before completing all tasks, you may need to re-enroll.
Certificate Access: Once you have completed the post-test and program evaluation, your certificate will be immediately available for download. Find Empathy will keep course certificates on file for 7 years. If a certificate is needed log into your Find Empathy account and download it, or contact:info@findempathy.com.
Post-test Retake Policy:You are allotted 3 retries to achieve the acceptable 75% passing grade.
This course is intended for psychologists, social workers, mental health counselors, and therapists. The instructional level is intermediate. We assume that participants already have psycho-oncology educational background and experience. The primary format is a non-interactive distance-learning continuing education course presented through a series of videos. There was no commercial support provided for this CE program, the content, or to the instructor(s).
Contact us atinfo@findempathy.com. We will do our best to return your email within 24-48 hours during business hours: Monday through Friday, 9am to 5pm eastern.If you have any questions, concerns, or grievances please email us atinfo@findempathy.com.You can also see our grievance policy via the following link:findempathy.com/grievance.
PSYCHOLOGISTS
Empathie, LLC is approved by the American Psychological Association to sponsor continuing education for psychologists. Empathie, LLC maintains responsibility for this program and its content.
COUNSELORS: Find Empathy has been approved by NBCC as an Approved Continuing Education Provider, ACEP No. 7257. Programs that do not qualify for NBCC credit are clearly identified. Find Empathy is solely responsible for all aspects of the program
SOCIAL WORKERS
Find Empathy, #1817, is approved to offer social work continuing education by the Association of Social Work Boards (ASWB) Approved Continuing Education (ACE) program. Organizations, not individual courses, are approved as ACE providers. State and provincial regulatory boards have the final authority to determine whether an individual course may be accepted for continuing education credit. Find Empathy maintains responsibility for this course. ACE provider approval period: 5/14/2023-5/14/2026. Social workers completing this course receive 7 continuing education credits.
Stem Cell Transplant and CAR T-cell Therapy: The Patient and Care Partner Experience,[course number],is approved by the Association of Social Work Boards (ASWB) Approved Continuing Education (ACE) program to be offered by Find Empathy as an individual course. Individual courses, not providers, are approved at the course level. State and provincial regulatory boards have the final authority to determine whether an individual course may be accepted for continuing education credit.ACE course approval period: [dates]. Social workers completing this course receive 7 continuing education credits.
Go here to read the rest:
Stem Cell Transplant and CAR T-cell Therapy: The Patient and Care Partner Experience | BMT Infonet - BMT Infonet |
BioRestorative Therapies to Present Preliminary BRTX-100 Clinical Data at the Orthopaedic Research Society (ORS … – OrthoSpineNews
Blinded data from the ongoing Phase 2 clinical trial of BRTX-100 to be described in poster presentation
Company to host webcasted conference call to review data on February 5, 2024 at 8:30am EST
MELVILLE, N.Y., Feb. 01, 2024 (GLOBE NEWSWIRE) BioRestorative Therapies, Inc. (BioRestorative, BRTX or the Company) (NASDAQ:BRTX), a clinical stage company focused on stem cell-based therapies, today announced that preliminary 2652 week blinded data from the ongoing Phase 2 clinical trial of BRTX-100 in subjects with chronic lumbar disc disease (cLDD) will be presented by Francisco Silva, Vice President of Research and Development, at the Orthopaedic Research Society (ORS) 2024 Annual Meeting, taking place February 2-6, 2024 in Long Beach, California.
BRTX-100, a novel cell-based therapeutic engineered to target areas of the body that have little blood flow, is the Companys lead clinical candidate. The safety and efficacy of BRTX-100 in treating cLDD is being evaluated in a Phase 2, prospective, randomized, double-blinded and controlled study. A total of up to 99 eligible subjects will be enrolled at up to 16 clinical sites in the United States. Subjects included in the trial will be randomized 2:1 to receive either BRTX-100 or placebo.
The presentation, titled Autologous Stem Cell Therapy for Chronic Lumbar Disc Disease, Initial Phase 2 Clinical Safety and Feasibility Data of Intradiscal Injections of Hypoxic Cultured Mesenchymal Stem Cells, is scheduled for Sunday, February 4, 2024 between 10:15am-11:15am PST.
We are excited by this opportunity to share, for the very first time, preliminary data from the ongoing Phase 2 clinical trial of BRTX-100 in the treatment of cLDD, said Lance Alstodt, Chief Executive Officer of BioRestorative. As interest in the potential clinical benefits of BRTX-100 grows, it is important that we continue to drive awareness of this novel therapeutic candidate amongst researchers, regulators and clinicians through clinical presentations at important meetings like ORS.
Conference Call & Webcast Details
BioRestorative management will host a webcasted conference call with an associated slide presentation at 8:30am EST on Monday, February 5, 2024 to review the BRTX-100 poster. To join the conference call via phone and participate in the live Q&A session, please dial 888-506-0062 (United States) or 973-528-0011 (International), participant access code 234972. The live webcast and audio archive of the presentation may be accessed on the investor section of the BioRestorative website athttps://www.biorestorative.com/investor-relations/. An archived replay will be available for approximately 90 days following the event.
About BioRestorative Therapies, Inc.
BioRestorative Therapies, Inc. (www.biorestorative.com) develops therapeutic products using cell and tissue protocols, primarily involving adult stem cells. Our two core programs, as described below, relate to the treatment of disc/spine disease and metabolic disorders:
Disc/Spine Program (brtxDISC): Our lead cell therapy candidate,BRTX-100,is a product formulated from autologous (or a persons own) cultured mesenchymal stem cells collected from the patients bone marrow. We intend that the product will be used for the non-surgical treatment of painful lumbosacral disc disorders or as a complementary therapeutic to a surgical procedure. TheBRTX-100production process utilizes proprietary technology and involves collecting a patients bone marrow, isolating and culturing stem cells from the bone marrow and cryopreserving the cells. In an outpatient procedure,BRTX-100is to be injected by a physician into the patients damaged disc. The treatment is intended for patients whose pain has not been alleviated by non-invasive procedures and who potentially face the prospect of surgery. We have commenced a Phase 2 clinical trial usingBRTX-100to treat chronic lower back pain arising from degenerative disc disease.
Metabolic Program (ThermoStem): We are developing a cell-based therapy candidate to target obesity and metabolic disorders using brown adipose (fat) derived stem cells to generate brown adipose tissue (BAT). BAT is intended to mimic naturally occurring brown adipose depots that regulate metabolic homeostasis in humans. Initial preclinical research indicates that increased amounts of brown fat in animals may be responsible for additional caloric burning as well as reduced glucose and lipid levels. Researchers have found that people with higher levels of brown fat may have a reduced risk for obesity and diabetes.
Forward-Looking Statements
This press release contains forward-looking statements within the meaning of Section 27A of the Securities Act of 1933, as amended, and Section 21E of the Securities Exchange Act of 1934, as amended, and such forward-looking statements are made pursuant to the safe harbor provisions of the Private Securities Litigation Reform Act of 1995. You are cautioned that such statements are subject to a multitude of risks and uncertainties that could cause future circumstances, events or results to differ materially from those projected in the forward-looking statements as a result of various factors and other risks, including, without limitation, those set forth in the Companys latest Form 10-K filed with the Securities and Exchange Commission. You should consider these factors in evaluating the forward-looking statements included herein, and not place undue reliance on such statements. The forward-looking statements in this release are made as of the date hereof and the Company undertakes no obligation to update such statements.
CONTACT: Email:ir@biorestorative.com
See original here:
BioRestorative Therapies to Present Preliminary BRTX-100 Clinical Data at the Orthopaedic Research Society (ORS ... - OrthoSpineNews
New FDA-approved sickle cell gene editing therapies offer hope for a pain-free life to patients some living in Colorado – Colorado Public Radio
Growing up, I really didnt have as many crises with sickle cell, Hymes said in a recent virtual interview from Arkansas. When I was getting older, I started having more and more sickle cell crises. But Ive always had this dream of becoming a physician, and as I got older, the more crises I had, the harder it made that journey.
A report from the Centers for Disease Control and Prevention (CDC) stated the origins of the pain: Sickled cells traveling through small blood vessels can get stuck and block blood flow throughout the body, causing pain. A pain crisis (vaso-occlusive episode or VOE) can start suddenly, be mild to severe, and can last for any length of time.
If you got hit by a bus and survived, all that excruciating pain that you would feel, thats how Id describe it. Id spend a week, two weeks, in the hospital, and then you have to recover, thats another week, and Id miss two weeks of class, Hymes said when explaining what living through a pain crisis has been like for him.
So, he looked for a solution by doing some online research that led him to McKinneys work.
We shot a few emails back and forth and it just felt like the right place to be I knew that the life I wanted and how it was going couldnt really co-exist, he said. Leading up to around the time I reached out to Dr. McKinney, I started to have crises almost every other month or sometimes even every month.
After he and McKinney developed an email relationship, Hymes came to Colorado for some blood work and testing and discovered he was a match for the trial.
Once it was determined that I could, I became a little more hopeful in the journey, said Hymes, who didnt dwell on the challenges of that journey, and instead honored the people who helped him through it: his mother, his girlfriend, and his grandparents all of whom came to visit him in Colorado, while he spent months coping with the complicated procedure.
We evaluate the patient to ensure their organs are healthy enough to tolerate the gene therapy process; we then start putting them on chronic transfusions where they get a monthly transfusion to decrease how much sickle hemoglobin they have," explained McKinney. "We give them medications to help them release their stem cells from their bone marrow into their blood and we hook them up to machines to collect those stem cells.
Its those cells that then get the gene therapy, they are edited to stop forming the sickle shape.
And that may take several months to get enough stem cells ... once weve collected those stem cells, we have to send those stem cells off to manufacture and to change the genes so that they make non-sickling hemoglobin. And that process can take about 12 weeks, McKinney said.
Patients then return for high doses of chemotherapy, which gets rid of the old bone marrow and makes room for the new.
Once they get that chemotherapy, we then infuse the stem cells, and it can take about four weeks for those cells to grow, McKinney said. The patient remains in the hospital while the new stem cells grow. Upon discharge, they have years of follow-up monitoring. Ultimately, patients who receive gene therapy need to be followed for about 15 years after the infusion to make sure theyre doing well."
For Hymes, things went according to plan. Because he was from out of town, he had to stay in Colorado for about six months in total. He said part of it was to have my edited genes put back in my body, and thats when I would have the chemo and stay in the hospital for an extended period of time.
Recovering from the chemotherapy, Hymes said, was one of the hardest parts.
I was still having to deal with the chemo and all the problems that it can cause. Its just this really bad taste you could have from the chemo and it could knock out your taste and you have a sore throat ... I guess Im a big eater, so food was the important part to me. But I drank a lot of Ensures just recovering from the chemo, said Hymes.
Now, two years since his journey began and one year after the transplant, Hymes said he feels like a new man.
It was a total change in my energy level and how I was able to just go about life! I didnt have to worry about having pain crises every other day or every month, said Hymes.
Regarding his pain crisis, Hymes said, Its almost non-existent at this point. I dont say almost non-existent. Its been non-existent at this point.
Like about 90 percent of McKinneys other trial participants, its all over now.
I havent had any crises since I had the stem cell transplant, and sickle cell-related problems since the transplant. So I would say it has been extremely beneficial in my life, said Hymes.He said it's also been good for his mother.
I only seen my mom cry one or two times, Hymes explained. One time was seeing him struggle with the disease, the other time, Hymes said, was seeing him leave it behind.
The two FDA-approved treatments are slightly different from what Hymes received but they work the same way, editing cells, and then returning them to the patient.
Now that the drug therapy has been approved, another component of McKinneys job is to let the rest of his patients the ones who werent part of a trial know about it. Some of those who werent in any of his trials experience pain from the disease serious enough to make the therapy worth considering.
A few weeks after the FDA announced its approval of the drugs in early December, McKinney met with Mia Hilton, a 20-year-old esthetician from Green Valley Ranch in Denver. Hilton has been McKinneys patient for the past 10 years. Vivacious and upbeat, she spent most of the meeting making funny comments. After a quick overall exam, he asked if shed heard about the newly approved gene therapies.
They are meant to be curative, he explained. Youd no longer have sickle cell after administration of them.
For her, that would be a big change. Like Hymes, sometimes, her pain got bad enough to go to the ER, where shed sometimes receive intravenous drugs.
Usually a pain crisis feels kind of like burning or stabbing a little bit. It can feel pretty hot internally in your muscles. I'll take a Benadryl and then they'll give me morphine through my IV, and that usually works, said Hilton. If not, she gets a nasal dose of fentanyl. In the ER, medical staff monitor her progress.
They usually do a chest X-ray to make sure that I'm not going to have a chest crisis, explained Hilton. And after a few hours, if the pain was under control, shed get discharged. I'll have somebody come and pick me up from the ER just because of the heavy medicines, they don't want me to drive.
Sometimes, when she didnt bounce back, she would be admitted from the ER into the hospital.
Usually my stay can range from three to seven days, so it does get pretty strenuous, she said.
She told McKinney that shed heard some pieces of information about the new gene therapies, but wanted to know more. In a cautious, gentle voice, he told her, The side effects of the chemo could cause infertility and hair loss.
Hilton had a quick answer to that.
Ive never wanted babies, she said, So its a free form of birth control.
I'm very into make-up and hair, so I already have 40 wigs in my closet, the bubbly woman added while already wearing eyelashes nearly an inch long. When McKinney mentioned that painful sores could form in her mouth, she didnt care about that either.
I bite my jaws a lot, so Im already there. I bit my tongue and my jaw four times in the elevator on the way up here, said Hilton.
Her reservations focused on the time shed lose working, and concerns about whether her case was severe enough to warrant the sacrifice.
I love science, so to hear that you're going to take something out, fix it, and put it back, it's like, Oh my gosh, that's kind of cool. Personally, I would definitely look into it, but ... I don't know if I would have the energy to do that. You know what I mean? I would be pretty much down to do it because I feel like in the long run, it could really help because having sickle cell, if you're not on top of it and you're not maintaining it, it can really slow you down ... So to get rid of crises altogether, that would be pretty ideal, said Hilton.
Although the side effects didnt bother Hilton, the cost could if her insurance wont cover it. One therapy costs $2 million, and the other is $3 million. But, according to Dr. David Rind, chief medical officer at the Institute for Clinical and Economic Review, a nonprofit that evaluates the prices and effectiveness of medications, that price wouldnt come out of the patients pocket. He said he expects insurance companies to cover the gene therapy.
I dont think any manufacturer would charge a price like that thinking only the patients who can afford it will get it, Rind said. I think the assumption is that insurance will pay for this ... I think this will be paid for, for almost anyone who wants it.
The rationale for why insurers should cover the gene therapies relates to slavery, he said.
The reason there is sickle cell in the U.S. is because we brought Africans over as slaves, Rind said. He explained that the disease is a gene mutation that fights malaria, a disease common in Africa. Thats why the people who are here have sickle cell . This is a population obligation in the United States to get this right.
Hymes has a sense of obligation, too, to other people born, like him, with the disease. Now that he has gotten rid of his crises as a clinical trial participant, what he thinks would be ideal is to become a doctor caring for people with sickle cell.
My entire life, Ive been extremely interested in hematology-oncology, of course, because that is what [sickle cell disease] is grouped as. But lately, Ive been interested in emergency medicine as well, because I know a lot of times we get seen on the front end in the emergency room, and thats where a lot of chronic pain patients get perceived as opioid-seeking, said Hymes.
He is now participating in an academic program for aspiring medical students while waiting to hear if hes been accepted to medical school. Once he has completed his medical degree, he said, he knows hed have the sensitivity to understand a sickle cell disease patients experience as real, not one of faking pain in the ER.
So either helping on that side or helping in the hematology and oncology area is what Im interested in. If I could do both or figure out a way to help all across the board, then Id probably choose that, too, said Hymes.
McKinney looks forward to offering his patients the choice of a different ending.
Now, when those families come in for their first visit with us to talk about what its going to look like for their child to live with sickle cell disease, we can at least provide them some hope that this is something that is very, very treatable, McKinney said. Something that if theyre having a lot of problems related to this, that we can potentially cure and get rid of.
Go here to see the original:
New FDA-approved sickle cell gene editing therapies offer hope for a pain-free life to patients some living in Colorado - Colorado Public Radio
‘Heart-on-a-Chip’ For Safer Cancer Treatment – Newswise
Newswise LOS ANGELES (Feb. 1, 2024) --Chemotherapy can be toxic to heart cells. To help protect the hearts of cancer patients, Cedars-Sinai investigators have created a three-dimensional heart-on-a-chip to evaluate drug safety. In a study published in the peer-reviewed journalLab on a Chip,they show that the heart-on-a-chip, created using stem cells, accurately predicts the effects of drugs on human heart cells.
The investigators worked with induced pluripotent stem cells, which are blood cells that have been reprogrammed into stem cells and can be turned into any cell type in the body. They used the stem cells to create two types of heart cells, but instead of placing them all together in an unstructured cell culture dish, as is usually done in heart toxicity testing, the investigators introduced the cells into specialized chips.
The 3D chips feature two channels that are arranged to cross each other, keeping each cell type separate but allowing them to interact. The chips also allow for movement and the introduction of fluids.
We grew heart muscle cells and blood vessel cells, saidArun Sharma, PhD, a research scientist in theBoard of Governors Regenerative Medicine Institute,Smidt Heart Institute,Cedars-Sinai Cancer, and theDepartment of Biomedical Sciencesat Cedars-Sinai and senior author of the study. The chip allows us to stretch the cells back and forth to mimic a heartbeat, and to introduce fluid to mimic the flow of blood through the heart. Its like giving the cells a workout that strengthens the muscle cells and allows the vessel cells to form mini blood vessel-like structures.
These matured cells provide a better test platform for drug toxicity studies than cells that havent undergone this maturation process because they more closely resemble the way adult heart cells function, Sharma said.
To demonstrate the proficiency of heart-on-a-chip as a drug-testing platform, the research team, including lead author and postdoctoral fellowMaedeh Mozneb, PhD, subjected the heart chip to a chemotherapy drug called a VEGFR/PDGFR-inhibiting tyrosine kinase inhibitor, which is known to have adverse effects on heart muscle and blood vessel cells. Damage was observed to both cell types in the heart chips.
If future studies continue to show good results, heart-on-a-chip technology could significantly reduce drug development costs and improve the rate at which new therapies become available.
Another future possibility for these heart chips is the creation of patient-specific chips to personalize cancer treatment.
If a patient with cancer might receive a treatment that could have adverse effects on their heart, we can create induced pluripotent stem cells from a small sample of their blood, Sharma said. We can turn those stem cells into heart muscle and blood vessel cells and put them on a chip that will serve as a personalized avatar for how that persons heart might react to the treatment. This is one of the most exciting applications of this technology, truly advancing personalized medicine at Cedars-Sinai.
Also a possibility: Taking these chips beyond a single organ.
We eventually hope to bring our various organ models together, saidClive Svendsen, PhD, executive director of the Board of Governors Regenerative Medicine Institute and co-author of the study. My lab has beenfine-tuning this technologyto help us develop models of neurological diseases, and other labs in our institute have been working on chips for the liver and the gut microbiome. Bringing all of these chips together to create a patient-on-a-chip model is part of our long-term vision for precision medicine.
Funding: This project was supported by American Heart Association Career Development Award 856987; National Institutes of Health grant numbers T32 HL116273, 1UG3TR003148, and 5UG3NS105703; Allen Distinguished Investigator Award number 12879; the Cedars-Sinai Board of Governors Regenerative Medicine Institute; and The ALS Association.
Read More from Discoveries:Regenerative MedicineA New Path for ALS Treatment
See the original post here:
'Heart-on-a-Chip' For Safer Cancer Treatment - Newswise
Rebirth Clinics Launches State-of-the-Art Stem Cell Centers in Abu Dhabi and Dubai – PR Web
Leading Regenerative Medicine, Rebirth Clinics Brings Innovative Stem Cell and Anti-Aging Therapies to the UAE
HONG KONG, Feb. 1, 2024 /PRNewswire-PRWeb/ -- Rebirth Clinics, a global leader in regenerative medicine products and services, today announced the launch of two of its "Rebirth Clinics" in Abu Dhabi and Dubai. The launch enables them to meet increasing market demand for stem cell treatments and Anti-Aging Therapies.
In addition to offering the highest-grade stem cell therapies available on the marketFour days old xeno-free stem cells sourced from fresh umbilical cord tissueRebirth Clinics also provide regenerative therapies including NAD+, Brain Peptides, Multi-Vitamins, and more.
"We are living in a historic time, where we are witnessing the emergence of stem cell therapy as a rapidly growing modality that will soon become a standard of care in modern medicine," said Ronny Shany, Founder of Rebirth Clinics, "Science has given us an amazing gift with stem cells; they are providing us with answers to medical challenges that have remained beyond our grasp for too long. At Rebirth, we fully embrace this gift, as there are so many diseases that can now be cured, and so many people suffering who can now be helped, it's good business and it's good medicine."
"We are thrilled to announce the expansion of Rebirth Clinics into Abu Dhabi," said Dr. Nashwa Al Ruwaini, CEO of Pyramedia Group, "This venture not only aligns with our commitment to healthcare innovation but also marks a significant step in making advanced regenerative medicine accessible in the region. Our collaboration with Rebirth Clinics LTD. is a testament to our dedication to bringing the latest in stem cell therapies and anti-aging treatments to our community. We envision a future where cutting-edge treatments like umbilical cord stem cell therapies become a cornerstone in modern healthcare. However, it's important to acknowledge that these forward-looking statements are based on current market trends and scientific advancements, and as the medical landscape evolves, so too may our strategies. We are committed to adapting and growing in this dynamic field".
"We are proud to be at the forefront of introducing revolutionary stem cell therapies to our patients", added Dr. Mohamed Al Ruwaini, Director of Delma Medical Center, "This collaboration with Rebirth Clinics in Abu Dhabi signifies a major leap in our mission to offer the most advanced medical treatments available. By integrating Rebirth Clinics' expertise in stem cell therapy, including their groundbreaking umbilical cord stem cell treatments, we are set to redefine healthcare standards in the region. Our commitment to excellence remains steadfast, even as we adapt to new developments and challenges in this pioneering area of healthcare".
Rebirth Clinics is a groundbreaking medical institute dedicated to transforming the landscape of advanced medical rejuvenation therapies using fresh Umbilical cord stem cells and IV treatments. As a leader in the regenerative medicine and the cellular therapy industry, Rebirth specializes in physician training certification, stem cell products, and IV therapies, with its lead product, fresh Umbilical cord stem cells. In addition, the organization is involved with the creation and management of stem cell clinics around the world.
"The opportunity to be a part of history at a time when we are witnessing an incredible paradigm shift in the use of stem cell therapy is monumental," said Derek Halpern, Chief Marketing Officer of Rebirth Clinics. "All advancements in science require time. By diversifying our regenerative medicine offerings, we are moving through this very important time in medicine while simultaneously making sure our customers continue to have a variety of safe and effective options for their care that will empower them to choose the product and/or service they feel is right for them."
For more information about Rebirth Cinics, visit their website at http://www.Rebirthglobe.com.
Media Contact
Derek Halpern, CMO, Rebirth Clinics, +1-5162346564, derek@svnetworx.com,http://Www.Rebirthglobe.com
SOURCE Rebirth Clinics
See the original post here:
Rebirth Clinics Launches State-of-the-Art Stem Cell Centers in Abu Dhabi and Dubai - PR Web
Houston regenerative medicine company to IPO, move toward more human trials – InnovationMap
Want a piece of one of Houstons most promising biotech companies? On January 31, FibroBiologics will begin the trading of its common stock on the Nasdaq stock exchange.
While most labs in the realm of regenerative medicine are focused on stem cells, FibroBiologics has bet on fibroblasts as the secret to treating myriad ailments. Fibroblasts, the most common type of cell in the body, are the primary cells that compose connective tissue.
Interested investors can find a prospectus to peruse before taking the leap. FibroBiologics filed with the U.S. Securities & Exchange Commission (SEC) on November 7, 2023. In September, FibroBiologics CEO Pete OHeeron told InnovationMap, I think what we're going to see is that fibroblasts are going to end up winning... They're just a better overall cell than the stem cells.
OHeeron was first exposed to the possibilities of fibroblasts as a means of regrowing discs in the spine. Since starting the company in 2008 as SpinalCyte, OHeeron and FibroBiologics have organically written and filed more than 320 patents. Potential treatments go far beyond spinal surgery to include wound care, cancer, and multiple sclerosis.
According to OHeeron, the goal in going public is to raise capital for human trials.
Weve had really fantastic results with animals and now were ready for humans, he explained in September. We've done small human trials, but we haven't done the large ones that are going to get the commercialization approval from the FDA.
FibroBiologics is growing with impressive speed. OHeeron told us that he is hiring as quickly as he is able to find qualified scientists with the expertise to do the one-of-a-kind work required. The company opened a new lab last fall at the UH Technology Bridge, Newlin-Linscomb Lab for Cell Therapies. With its new status as a publicly traded company, FibroBiologics is primed to break even more ground.
See the article here:
Houston regenerative medicine company to IPO, move toward more human trials - InnovationMap
It’s been a struggle getting out of bed – Liam Harrison on the sheer difficulty of living through injuries before stem cell … – Sportskeeda
Combat sports is often a cruel mistress, and Liam Harrison knows that price all too well.
Behind his world titles, accolades, and overall praise, Harrison also had to deal with the physical toll of achieving such greatness.
In an interview with the South China Morning Post, the British Muay Thai legend discussed how his daily life became a constant struggle after he put his body through immense damage throughout his entire career.
Harrison practically lived on one leg after he suffered a nasty knee injury during his world title fight against Thai legend Nong-O Hama at ONE on Prime Video 1.
Apart from a shattered left knee, Liam Harrison also dealt with the lingering pain that he went through before he challenged for the ONE bantamweight Muay Thai world title in August 2022.
He said:
Things only got better for Harrison when he underwent stem cell treatment in Costa Rica earlier this year, and it was a lofty price to keep his body from breaking down even before he reached 40 years old.
Harrison has since returned to training and is looking forward to what could be his final fight in ONE Championship.
Watch Harrison's entire interview below:
Liam Harrison has no apprehensions about his impending retirement, and he already named the fighter he wants to share the ring with for the final time in his career.
In the same interview, Harrison expressed his desire to take on Seksan Or Kwanmuang for his retirement bout:
See original here:
It's been a struggle getting out of bed - Liam Harrison on the sheer difficulty of living through injuries before stem cell ... - Sportskeeda