The long and winding road of reprogramming-induced rejuvenation – Nature.com

Vos, T. et al. Global Burden of 369 Diseases and Injuries in 204 Countries and territories, 19902019: a Systematic Analysis for the Global Burden of Disease Study 2019. Lancet 396, 12041222 (2020).

Article Google Scholar

Yang, J. H. et al. Loss of epigenetic information as a cause of mammalian aging. Cell 186, 305326 (2023).

Article CAS PubMed PubMed Central Google Scholar

Duffield T. et al Epigenetic fidelity in complex biological systems and implications for ageing. Biorxiv. Published online April 30 https://doi.org/10.1101/2023.04.29.538716 (2023).

Kerepesi, C., Zhang, B., Lee, S. G., Trapp, A. & Gladyshev, V. N. Epigenetic clocks reveal a rejuvenation event during embryogenesis followed by aging. Sci. Adv. 7, eabg6082 (2021).

Article ADS CAS PubMed PubMed Central Google Scholar

Zhang B. et al. Epigenetic profiling and incidence of disrupted development point to gastrulation as aging ground zero in Xenopus laevis. Biorxiv. Published online August 4 https://doi.org/10.1101/2022.08.02.502559 (2022).

Horvath, S. DNA methylation age of human tissues and cell types. Genome Biol. 14, R115 (2013).

Article PubMed PubMed Central Google Scholar

Simpson D. J., Olova N. N., Chandra T. Cellular reprogramming and epigenetic rejuvenation. Clin. Epigenetics. 13, https://doi.org/10.1186/s13148-021-01158-7 (2021).

Ocampo, A. et al. In vivo amelioration of age-associated hallmarks by partial reprogramming. Cell 167, 17191733.e12 (2016).

Article CAS PubMed PubMed Central Google Scholar

Manukyan M., Singh P. B. Epigenome rejuvenation: HP1 mobility as a measure of pluripotent and senescent chromatin ground states. Sci. Rep. 4, https://doi.org/10.1038/srep04789 (2014).

Sarkar, T. J. et al. Transient non-integrative expression of nuclear reprogramming factors promotes multifaceted amelioration of aging in human cells. Nat. Commun. 11, 1545 (2020).

Article ADS CAS PubMed PubMed Central Google Scholar

Chondronasiou, D. et al. Multiomic rejuvenation of naturally aged tissues by a single cycle of transient reprogramming. Aging Cell 21, e13578 (2022).

Article CAS PubMed PubMed Central Google Scholar

Gill, D. et al. Multi-omic rejuvenation of human cells by maturation phase transient reprogramming. eLife 11, e71624 (2022).

Article CAS PubMed PubMed Central Google Scholar

Olova, N., Simpson, D. J., Marioni, R. E. & Chandra, T. Partial reprogramming induces a steady decline in epigenetic age before loss of somatic identity. Aging Cell 18, e12877 (2018).

Article PubMed PubMed Central Google Scholar

Lu, Y. et al. Reprogramming to recover youthful epigenetic information and restore vision. Nature 588, 124129 (2020).

Article ADS CAS PubMed PubMed Central Google Scholar

Browder, K. C. et al. In vivo partial reprogramming alters age-associated molecular changes during physiological aging in mice. Nat. Aging 2, 243253 (2022).

Article CAS PubMed Google Scholar

Macip C. C. et al. Gene therapy mediated partial reprogramming extends lifespan and reverses age-related changes in aged mice. Biorxiv. Published online January 5, 2023. https://doi.org/10.1101/2023.01.04.522507.

Pupo, A. et al. AAV vectors: The Rubiks cube of human gene therapy. Mol. Ther.: J. Am. Soc. Gene Ther. 30, 35153541 (2022).

Article CAS Google Scholar

Wang, C. et al. In vivo partial reprogramming of myofibers promotes muscle regeneration by remodeling the stem cell niche. Nat. Commun. 12, 3094 (2021).

Article ADS CAS PubMed PubMed Central Google Scholar

Hou, P. et al. Pluripotent stem cells induced from mouse somatic cells by small-molecule compounds. Science 341, 651654 (2013).

Article ADS CAS PubMed Google Scholar

Schoenfeldt L. et al. Chemical reprogramming ameliorates cellular hallmarks of aging and extends lifespan. Biorxiv. Published online August 31, (2022). https://doi.org/10.1101/2022.08.29.505222.

Guan J. et al. Chemical reprogramming of human somatic cells to pluripotent stem cells. Nature 605, 325331 (2022).

Liuyang, Shijia et al. Highly efficient and rapid generation of human pluripotent stem cells by chemical reprogramming. Cell Stem Cell 30, 450459.e9 (2023).

Article CAS PubMed Google Scholar

Mitchell W. et al. Multi-omics characterization of partial chemical reprogramming reveals evidence of cell rejuvenation. Biorxiv. Published online June 30, 2023. https://doi.org/10.1101/2023.06.30.546730.

Hong, H. et al. Suppression of induced pluripotent stem cell generation by the p53p21 pathway. Nature 460, 11321135 (2009).

Article ADS CAS PubMed PubMed Central Google Scholar

Levine, A. J., Puzio-Kuter, A. M., Chan, C. S. & Hainaut, P. The role of the p53 protein in stem-cell biology and epigenetic regulation. Cold Spring Harb. Perspect. Med. 6, a026153 (2016).

Article PubMed PubMed Central Google Scholar

Tyner, S. D. et al. p53 mutant mice that display early ageing-associated phenotypes. Nature 415, 4553 (2002).

Article ADS CAS PubMed Google Scholar

Hu, X., Eastman, A. E. & Guo, S. Cell cycle dynamics in the reprogramming of cellular identity. FEBS Lett. 593, 28402852 (2019).

Article CAS PubMed Google Scholar

Mosteiro, Lluc, Pantoja, C., de Martino, Alba & Serrano, M. Senescence promotes in vivo reprogramming through p16INK 4a and IL-6. Aging Cell 17, e12711e12711 (2017).

Article PubMed PubMed Central Google Scholar

Mosteiro, L. et al. Tissue damage and senescence provide critical signals for cellular reprogramming in vivo. Sci. (N. Y., NY) 354, aaf4445 (2016).

Article Google Scholar

Chen, Y. et al. Reversible reprogramming of cardiomyocytes to a fetal state drives heart regeneration in mice. Science 373, 15371540 (2021).

Article ADS CAS PubMed Google Scholar

Lpez-Otn, C., Blasco, M. A., Partridge, L., Serrano, M. & Kroemer, G. Hallmarks of aging: An expanding universe. Cell 186, 243278 (2023).

Article PubMed Google Scholar

Horvath, S. et al. Epigenetic clock for skin and blood cells applied to Hutchinson Gilford Progeria Syndrome and ex vivo studies. Aging 10, 17581775 (2018).

Article CAS PubMed PubMed Central Google Scholar

Kabacik, S. et al. The relationship between epigenetic age and the hallmarks of aging in human cells. Nat. Aging 2, 484493 (2022).

Article PubMed PubMed Central Google Scholar

Takahashi, K. & Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663676 (2006).

Article CAS PubMed Google Scholar

Rouhani, F. J. et al. Substantial somatic genomic variation and selection for BCOR mutations in human induced pluripotent stem cells. Nat. Genet. 54, 14061416 (2022).

Article CAS PubMed PubMed Central Google Scholar

DAntonio, M. et al. Insights into the mutational burden of human induced pluripotent stem cells from an integrative multi-omics approach. Cell Rep. 24, 883894 (2018).

Article PubMed PubMed Central Google Scholar

Kosanke, M. et al. Reprogramming enriches for somatic cell clones with small-scale mutations in cancer-associated genes. Mol. Ther.: J. Am. Soc. Gene Ther. 29, 25352553 (2021).

Article CAS Google Scholar

Young, MargaretA. et al. Background mutations in parental cells account for most of the genetic heterogeneity of induced pluripotent stem cells. Cell Stem Cell 10, 570582 (2012).

Article CAS PubMed PubMed Central Google Scholar

Poganik J. R. et al. Biological age is increased by stress and restored upon recovery. Cell Metab. Published online April 4, 2023:S1550-4131(23)000931. https://doi.org/10.1016/j.cmet.2023.03.015.

Hannum, G. et al. Genome-wide methylation profiles reveal quantitative views of human aging rates. Mol. Cell 49, 359367 (2013).

Article CAS PubMed Google Scholar

Levine, M. E. et al. An epigenetic biomarker of aging for lifespan and healthspan. Aging (Albany NY) 10, 573591 (2018).

Article PubMed Google Scholar

Lu, A. T. et al. DNA methylation GrimAge strongly predicts lifespan and healthspan. Aging 11, 303327 (2019).

Article CAS PubMed PubMed Central Google Scholar

Ying K. et al. Causality-enriched epigenetic age uncouples damage and adaptation. Nature Aging. Published online January 19, 2024. https://doi.org/10.1038/s43587-023-00557-0.

Nikopoulou, C. et al. Spatial and single-cell profiling of the metabolome, transcriptome and epigenome of the aging mouse liver. Nat. Aging 3, 14301445 (2023).

Article CAS PubMed PubMed Central Google Scholar

Marin, R. M. et al. A p53-mediated DNA damage response limits reprogramming to ensure iPS cell genomic integrity. Nature 460, 11491153 (2009).

Article ADS PubMed PubMed Central Google Scholar

Liu, X. et al. Yamanaka factors critically regulate the developmental signaling network in mouse embryonic stem cells. Cell Res. 18, 11771189 (2008).

Article CAS PubMed Google Scholar

Arabac, D. H., Terziolu, G., Bayrba, B. & nder, T. T. Going up the hill: Chromatinbased barriers to epigenetic reprogramming. FEBS J. 288, 47984811 (2020).

Article PubMed Google Scholar

Mertens, J., Reid, D., Lau, S., Kim, Y. & Gage, F. H. Aging in a dish: iPSC-derived and directly induced neurons for studying brain aging and age-related neurodegenerative diseases. Annu. Rev. Genet. 52, 271293 (2018).

Article CAS PubMed PubMed Central Google Scholar

Sheng C. et al. A stably self-renewing adult blood-derived induced neural stem cell exhibiting patternability and epigenetic rejuvenation. Nat. Commun. 9, https://doi.org/10.1038/s41467-018-06398-5 (2018).

Shi, G. & Jin, Y. Role of Oct4 in maintaining and regaining stem cell pluripotency. Stem Cell Res. Ther. 1, 39 (2010).

Article CAS PubMed PubMed Central Google Scholar

Kriukov D., Khrameeva E. E., Gladyshev V. N., Dmitriev S. E., Tyshkovskiy A. Longevity and rejuvenation effects of cell reprogramming are decoupled from loss of somatic identity. Biorxiv. Published online December 14, 2022. https://doi.org/10.1101/2022.12.12.520058.

Teshigawara, R., Cho, J., Kameda, M. & Tada, T. Mechanism of human somatic reprogramming to iPS cell. Lab. Investig. 97, 11521157 (2017).

Article CAS PubMed Google Scholar

Wang, B. et al. Induction of pluripotent stem cells from mouse embryonic fibroblasts by Jdp2-Jhdm1b-Mkk6-Glis1-Nanog-Essrb-Sall4. Cell Rep. 27, 34733485.e5 (2019).

Article CAS PubMed Google Scholar

Adachi, K. et al. Esrrb unlocks silenced enhancers for reprogramming to naive pluripotency. Cell Stem Cell 23, 266275.e6 (2018).

Article CAS PubMed Google Scholar

Carbognin E. et al. Esrrb guides naive pluripotent cells through the formative transcriptional programme. Nat. Cell Biol. 25, 643657 (2023).

Nakagawa, M., Takizawa, N., Narita, M., Ichisaka, T. & Yamanaka, S. Promotion of direct reprogramming by transformation-deficient Myc. Proc. Natl. Acad. Sci. 107, 1415214157 (2010).

Article ADS CAS PubMed PubMed Central Google Scholar

Onder, T. T. et al. Chromatin-modifying enzymes as modulators of reprogramming. Nature 483, 598602 (2012).

Continued here:
The long and winding road of reprogramming-induced rejuvenation - Nature.com

Looking for the Path to Safe Cell Rejuvenation – Lifespan.io News

In Nature Communications, Ali Ycel and Vadim Gladyshev have published a review of the current state of the art in partial cellular reprogramming, detailing what this technology does and how it might be used safely.

This paper begins by treading familiar ground on the subject, explaining its end goals and purpose. When successful, partial cellular reprogramming induces reprogramming-induced rejuvenation (RIR), a state in which a cell is transformed into an epigenetically younger cell of the same type and fulfilling the same function [1]. This process has had multiple crucial successes in experimental models, including human muscle cells [2] and skin cells [3] along with restoring vision [4] and extending lifespan [5] in mice.

Much of this work has been done in mice that have been genetically modified to express the necessary factors when doxycycline is administered. This has even been accomplished after birth via an adeno-associated virus (AAV) [5]. While there are four Yamanaka factors, OSKM, the fourth, c-Myc, is often omitted because it raises the risk of cancer. OSK administration significantly reduced the frailty of the treated mice.

As the authors note, applying these sorts of genetic modification techniques directly to human beings is currently infeasible with existing technologies. Partial reprogramming requires carefully determined generation of Yamanaka factors inside cells. To apply this in a clinical setting would require gene therapy that has specific and strong effects on individual tissues, and using the AAV system that works on mice is not yet practical for people [6]. Generating partially reprogrammed cells outside the body, similarly to how induced pluripotent stem cells (iPSCs) are generated, may be feasible for therapeutic purposes.

Administering small molecules to people in order to effect rejuvenation in the form of a drug has been the dream of aging researchers for some time. Previous work has spurred the creation of iPSCs through such chemical means [7]. The authors of this review describe these methods as less powerful than gene therapy and requiring multiple stages of administration. This implies a degree of safety and control that makes them more attractive for human research.

An experiment on mouse cells, which also included Vadim Gladyshev, had revealed that using a 7c cocktail reduced multiple aspects of aging, including epigenetic clock measurements, age-related metabolic changes, and oxidative stress markers [8]. However, it also upregulates the senescence-associated p53 pathway, which is downregulated through normal reprogramming methods and may cause cells to become senescent earlier [9].

Normally, constant expression of the Yamanaka factors in a living organism causes its cells to completely revert to a pluripotent state, in which they forget their roles, become cancerous, and cause the organism to die. For example, inducing OSKM for six days in the hearts of mice was found to be beneficial for them, while extending it for a dozen days proved lethal [10]. However, constantly inducing OSK in neural ganglion cells for a full 10-18 months improved vision without this side effect [4].

The authors note many of the aspects of aging that are improved or possibly improved with RIR, of which the most obvious, epigenetic alterations, is only one. Inflammation and proteostasis are also affected. Telomere attrition, however, occurs only in later reprogramming and is not affected by the partial variety [11]. Direct changes to cellular communication and genomic stability are not yet known.

However, the authors point out that, while full reprogramming does not cells to mutate, creating colonies of iPSCs causes evolutionary pressure: cells with mutations that may not be beneficial for the whole organism may be more prevalent in iPSC colonies [12]. It remains to be seen if this is a concern for partial reprogramming.

The authors also mention a biochemical pluripotency network and the fundamental differences between full and partial rejuvenation. Most critically, they hold that partial reprogramming is caused by factors that are downstream of full reprogramming. If it is possible to directly affect these factors instead of relying on the Yamanaka full-reprogramming factors, it might be possible to cause RIR without risking the dangerous side effects associated with complete reprogramming. However, this area of research remains unexplored.

To do this, we need your support. Your charitable contribution tranforms into rejuvenation research, news, shows, and more. Will you help?

[1] Ocampo, A., Reddy, P., Martinez-Redondo, P., Platero-Luengo, A., Hatanaka, F., Hishida, T., & Belmonte, J. C. I. (2016). In vivo amelioration of age-associated hallmarks by partial reprogramming. Cell, 167(7), 1719-1733.

[2] Sarkar, T. J., Quarta, M., Mukherjee, S., Colville, A., Paine, P., Doan, L., & Sebastiano, V. (2020). Transient non-integrative expression of nuclear reprogramming factors promotes multifaceted amelioration of aging in human cells. Nature communications, 11(1), 1545.

[3] Gill, D., Parry, A., Santos, F., Okkenhaug, H., Todd, C. D., Hernando-Herraez, I., & Reik, W. (2022). Multi-omic rejuvenation of human cells by maturation phase transient reprogramming. Elife, 11, e71624.

[4] Lu, Y., Brommer, B., Tian, X., Krishnan, A., Meer, M., Wang, C., & Sinclair, D. A. (2020). Reprogramming to recover youthful epigenetic information and restore vision. Nature, 588(7836), 124-129.

[5] Macip, C. C., Hasan, R., Hoznek, V., Kim, J., Lu, Y. R., Metzger IV, L. E., & Davidsohn, N. (2024). Gene Therapy-Mediated Partial Reprogramming Extends Lifespan and Reverses Age-Related Changes in Aged Mice. Cellular Reprogramming, 26(1), 24-32.

[6] Pupo, A., Fernndez, A., Low, S. H., Franois, A., Surez-Amarn, L., & Samulski, R. J. (2022). AAV vectors: The Rubiks cube of human gene therapy. Molecular Therapy.

[7] Guan, J., Wang, G., Wang, J., Zhang, Z., Fu, Y., Cheng, L., & Deng, H. (2022). Chemical reprogramming of human somatic cells to pluripotent stem cells. Nature, 605(7909), 325-331.

[8] Mitchell, W., Goeminne, L. J., Tyshkovskiy, A., Zhang, S., Chen, J. Y., Paulo, J. A., & Gladyshev, V. N. (2023). Multi-omics characterization of partial chemical reprogramming reveals evidence of cell rejuvenation. bioRxiv, 2023-06.

[9] Tyner, S. D., Venkatachalam, S., Choi, J., Jones, S., Ghebranious, N., Igelmann, H., & Donehower, L. A. (2002). p53 mutant mice that display early ageing-associated phenotypes. Nature, 415(6867), 45-53.

[10] Chen, Y., Lttmann, F. F., Schoger, E., Schler, H. R., Zelarayn, L. C., Kim, K. P., & Braun, T. (2021). Reversible reprogramming of cardiomyocytes to a fetal state drives heart regeneration in mice. Science, 373(6562), 1537-1540.

[11] Takahashi, K., & Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. cell, 126(4), 663-676.

[12] Kosanke, M., Osetek, K., Haase, A., Wiehlmann, L., Davenport, C., Schwarzer, A., & Martin, U. (2021). Reprogramming enriches for somatic cell clones with small-scale mutations in cancer-associated genes. Molecular Therapy, 29(8), 2535-2553.

Read the original post:
Looking for the Path to Safe Cell Rejuvenation - Lifespan.io News

Lessons from inducible pluripotent stem cell models on neuronal senescence in aging and neurodegeneration – Nature.com

Lpez-Otn, C., Blasco, M. A., Partridge, L., Serrano, M. & Kroemer, G. Hallmarks of aging: an expanding universe. Cell 186, 243278 (2023).

Article PubMed Google Scholar

Hayflick, L. & Moorhead, P. S. The serial cultivation of human diploid cell strains. Exp. Cell. Res. 25, 585621 (1961).

Article CAS PubMed Google Scholar

Harley, C. B., Vaziri, H., Counter, C. M. & Allsopp, R. C. The telomere hypothesis of cellular aging. Exp. Gerontol. 27, 375382 (1992).

Article CAS PubMed Google Scholar

Gorgoulis, V. et al. Cellular senescence: defining a path forward. Cell 179, 813827 (2019).

Article CAS PubMed Google Scholar

Copp, J. P., Desprez, P. Y., Krtolica, A. & Campisi, J. The senescence-associated secretory phenotype: the dark side of tumor suppression. Annu. Rev. Pathol. 5, 99118 (2010).

Article PubMed PubMed Central Google Scholar

Herdy, J. R. et al. Increased post-mitotic senescence in aged human neurons is a pathological feature of Alzheimers disease. Cell Stem Cell 29, 16371652 (2022).

Article Google Scholar

Ng, P. Y., McNeely, T. L. & Baker, D. J. Untangling senescent and damage-associated microglia in the aging and diseased brain. FEBS J. 290, 13261339 (2023).

Article CAS PubMed Google Scholar

van Deursen, J. M. The role of senescent cells in ageing. Nature 509, 439446 (2014).

Article ADS PubMed PubMed Central Google Scholar

Crouch, J., Shvedova, M., Thanapaul, R., Botchkarev, V. & Roh, D. Epigenetic regulation of cellular senescence. Cells 11, 672 (2022).

Article CAS PubMed PubMed Central Google Scholar

Kowald, A., Passos, J. F. & Kirkwood, T. B. L. On the evolution of cellular senescence. Aging Cell 19, e13270 (2020).

Article CAS PubMed PubMed Central Google Scholar

Miwa, S., Kashyap, S., Chini, E. & von Zglinicki, T. Mitochondrial dysfunction in cell senescence and aging. J. Clin. Invest. 132, e158447 (2022).

Article CAS PubMed PubMed Central Google Scholar

Muoz-Espn, D. et al. Programmed cell senescence during mammalian embryonic development. Cell 155, 11041118 (2013).

Article PubMed Google Scholar

Gibaja, A. et al. TGF2-induced senescence during early inner ear development. Sci. Rep. 9, 5912 (2019).

Article ADS PubMed PubMed Central Google Scholar

Reichel, W., Hollander, J., Clark, J. H. & Strehler, B. L. Lipofuscin pigment accumulation as a function of age and distribution in rodent brain. J. Gerontol. 23, 7178 (1968).

Article CAS PubMed Google Scholar

Moreno-Garca, A., Kun, A., Calero, O., Medina, M. & Calero, M. An overview of the role of lipofuscin in age-related neurodegeneration. Front. Neurosci. 12, 464 (2018).

Article PubMed PubMed Central Google Scholar

Xu, P. et al. The landscape of human tissue and cell type specific expression and co-regulation of senescence genes. Mol. Neurodegener. 17, 5 (2022).

Article CAS PubMed PubMed Central Google Scholar

Saul, D. et al. A new gene set identifies senescent cells and predicts senescence-associated pathways across tissues. Nat. Commun. 13, 4827 (2022).

Article ADS CAS PubMed PubMed Central Google Scholar

Ogrodnik, M. et al. Whole-body senescent cell clearance alleviates age-related brain inflammation and cognitive impairment in mice. Aging Cell 20, e13296 (2021).

Article CAS PubMed PubMed Central Google Scholar

Bussian, T. J. et al. Clearance of senescent glial cells prevents tau-dependent pathology and cognitive decline. Nature 562, 578582 (2018).

Article ADS CAS PubMed PubMed Central Google Scholar

Musi, N. et al. Tau protein aggregation is associated with cellular senescence in the brain. Aging Cell 17, e12840 (2018).

Article PubMed PubMed Central Google Scholar

Rocha, L. R. et al. Early removal of senescent cells protects retinal ganglion cells loss in experimental ocular hypertension. Aging Cell 19, e13089 (2020).

Article CAS PubMed Google Scholar

Zhang, P. et al. Senolytic therapy alleviates A-associated oligodendrocyte progenitor cell senescence and cognitive deficits in an Alzheimers disease model. Nat. Neurosci. 22, 719728 (2019).

Article CAS PubMed PubMed Central Google Scholar

Chinta, S. J. et al. Cellular senescence is induced by the environmental neurotoxin paraquat and contributes to neuropathology linked to Parkinsons disease. Cell Rep. 22, 930940 (2018).

Article CAS PubMed PubMed Central Google Scholar

Gonzales, M. M. et al. Senolytic therapy to modulate the progression of Alzheimers disease (SToMP-AD): a pilot clinical trial. J. Prev. Alzheimers Dis. 9, 2229 (2022).

CAS PubMed Google Scholar

Dehkordi, S. K. et al. Profiling senescent cells in human brains reveals neurons with CDKN2D/p19 and tau neuropathology. Nat. Aging 1, 11071116 (2021).

Article PubMed PubMed Central Google Scholar

Langfelder, P. & Horvath, S. Eigengene networks for studying the relationships between co-expression modules. BMC Syst. Biol. 1, 54 (2007).

Article PubMed PubMed Central Google Scholar

Geng, Y. Q., Guan, J. T., Xu, X. H. & Fu, Y. C. Senescence-associated beta-galactosidase activity expression in aging hippocampal neurons. Biochem. Biophys. Res. Commun. 396, 866869 (2010).

Article CAS PubMed Google Scholar

Bhanu, M. U., Mandraju, R. K., Bhaskar, C. & Kondapi, A. K. Cultured cerebellar granule neurons as an in vitro aging model: topoisomerase II as an additional biomarker in DNA repair and aging. Toxicol. In Vitro 24, 19351945 (2010).

Article PubMed Google Scholar

de Mera-Rodrguez, J. A. et al. Endogenous pH 6.0 -galactosidase activity is linked to neuronal differentiation in the olfactory epithelium. Cells 11, 298 (2022).

Article PubMed PubMed Central Google Scholar

Piechota, M. et al. Is senescence-associated -galactosidase a marker of neuronal senescence? Oncotarget 7, 8109981109 (2016).

Article PubMed PubMed Central Google Scholar

Jurk, D. et al. Postmitotic neurons develop a p21-dependent senescence-like phenotype driven by a DNA damage response. Aging Cell 11, 9961004 (2012).

Article CAS PubMed Google Scholar

Moreno-Blas, D. et al. Cortical neurons develop a senescence-like phenotype promoted by dysfunctional autophagy. Aging 11, 61756198 (2019).

Article CAS PubMed PubMed Central Google Scholar

Bigagli, E. et al. Long-term neuroglial cocultures as a brain aging model: hallmarks of senescence, microRNA expression profiles, and comparison with in vivo models. J. Gerontol. A Biol. Sci. Med. Sci. 71, 5060 (2016).

Article CAS PubMed Google Scholar

Kang, H. T., Lee, K. B., Kim, S. Y., Choi, H. R. & Park, S. C. Autophagy impairment induces premature senescence in primary human fibroblasts. PLoS ONE 6, e23367 (2011).

Article ADS CAS PubMed PubMed Central Google Scholar

Wong, A., Kieu, T. & Robbins, P. D. The Ercc1/ mouse model of accelerated senescence and aging for identification and testing of novel senotherapeutic interventions. Aging 12, 2448124483 (2020).

Article CAS PubMed PubMed Central Google Scholar

Yousefzadeh, M. J. et al. Tissue specificity of senescent cell accumulation during physiologic and accelerated aging of mice. Aging Cell 19, e13094 (2020).

Article CAS PubMed PubMed Central Google Scholar

de Waard, M. C. et al. Age-related motor neuron degeneration in DNA repair-deficient Ercc1 mice. Acta Neuropathol. 120, 461475 (2010).

Article CAS PubMed PubMed Central Google Scholar

Doll, M. E. et al. Broad segmental progeroid changes in short-lived Ercc1/7 mice. Pathobiol. Aging Age Relat. Dis. 1, 10.3402/pba.v1i0.7219(2011).

Sepe, S. et al. Inefficient DNA repair Is an aging-related modifier of Parkinsons disease. Cell Rep. 15, 18661875 (2016).

Article CAS PubMed PubMed Central Google Scholar

Pachajoa, H. et al. HutchinsonGilford progeria syndrome: clinical and molecular characterization. Appl. Clin. Genet. 13, 159164 (2020).

Article CAS PubMed PubMed Central Google Scholar

Machiela, E. et al. The interaction of aging and cellular stress contributes to pathogenesis in mouse and human huntington disease neurons. Front Aging Neurosci. 12, 524369 (2020).

Article CAS PubMed PubMed Central Google Scholar

Baek, J. H. et al. Expression of progerin in aging mouse brains reveals structural nuclear abnormalities without detectible significant alterations in gene expression, hippocampal stem cells or behavior. Hum. Mol. Genet. 24, 13051321 (2015).

Article CAS PubMed Google Scholar

Arendt, T., Rdel, L., Grtner, U. & Holzer, M. Expression of the cyclin-dependent kinase inhibitor p16 in Alzheimers disease. Neuroreport 7, 30473049 (1996).

Article CAS PubMed Google Scholar

McShea, A., Harris, P. L., Webster, K. R., Wahl, A. F. & Smith, M. A. Abnormal expression of the cell cycle regulators P16 and CDK4 in Alzheimers disease. Am. J. Pathol. 150, 19331939 (1997).

CAS PubMed PubMed Central Google Scholar

Wang, B. et al. An inducible p21-Cre mouse model to monitor and manipulate p21-highly-expressing senescent cells in vivo. Nat. Aging 1, 962973 (2021).

Article PubMed PubMed Central Google Scholar

Hu, W. et al. Direct conversion of normal and Alzheimers disease human fibroblasts into neuronal cells by small molecules. Cell Stem Cell 17, 204212 (2015).

Article CAS PubMed Google Scholar

Mertens, J. et al. Directly reprogrammed human neurons retain aging-associated transcriptomic signatures and reveal age-related nucleocytoplasmic defects. Cell Stem Cell 17, 705718 (2015).

Article CAS PubMed PubMed Central Google Scholar

Yoo, A. S. et al. MicroRNA-mediated conversion of human fibroblasts to neurons. Nature 476, 228231 (2011).

Article ADS CAS PubMed PubMed Central Google Scholar

Capano, L. S. et al. Recapitulation of endogenous 4R tau expression and formation of insoluble tau in directly reprogrammed human neurons. Cell Stem Cell 29, 918932 (2022).

Article CAS PubMed PubMed Central Google Scholar

Zhang, C. et al. Establishing RNAge to score cellular aging and rejuvenation paradigms and identify novel age-modulating compounds. Preprint at bioRxiv https://doi.org/10.1101/2023.07.03.547539 (2023).

Sun, Z. et al. Endogenous recapitulation of Alzheimers disease neuropathology through human 3D direct neuronal reprogramming. Preprint at bioRxiv https://doi.org/10.1101/2023.05.24.542155 (2023).

Thomson, J. A. et al. Embryonic stem cell lines derived from human blastocysts. Science 282, 11451147 (1998).

See original here:
Lessons from inducible pluripotent stem cell models on neuronal senescence in aging and neurodegeneration - Nature.com

Company Trying to Resurrect a Mammoth Makes a Stem Cell Breakthrough – Gizmodo

Colossal Biosciences, which calls itself the worlds first de-extinction company, has created stem cells it thinks will hasten the companys marquee goal of resurrecting the woolly mammoth. The teams research describing the accomplishment will be hosted on the preprint server bioRxiv.

What Drew John Boyega Back Into Sci-Fi? | io9 Interview

The cells are induced pluripotent stem cells (iPSC), a type of cell that can be reprogrammed to develop into any other type of cell. The cells are especially useful in bioengineering, for their applications in cell development, therapy, and transferring genetic information across species. Colossals new iPSCs are the first engineered elephant cells converted into an embryonic state, a useful development if youre in pursuit of a woolly mammoth. Or rather, an animal that looks like a woolly mammoth.

In the past, a multitude of attempts to generate elephant iPSCs have not been fruitful. Elephants are a very special species and we have only just begun to scratch the surface of their fundamental biology, said Eriona Hysolli, who heads up Colossals biological sciences team, in a statement. The Colossal mammoth team persisted quite successfully as this progress is invaluable for the future of elephant assisted reproductive technologies as well as advanced cellular modeling of mammoth phenotypes.

According to the Colossal release, the new stem cells were able to differentiate into the three germ layers that result in every cell type. It opens the door to establishing connections between genes and traits for both modern and extinct relativesincluding resistance to environmental extremes and pathogens, said George Church, a geneticist and co-founder of Colossal, in a press release.

The animals Colossal hopes to produce will be Asian elephants (E. maximus), genetically engineered to be resistant to the cold and, most notably, covered in shaggy hair la woolly mammoth, their extinct cousin. Colossal also has plans to produce approximate (or proxy) species of the Tasmanian tiger or thylacine, which went extinct around 1936, and the dodo, a flightless bird native to Mauritius, which was gone by 1681. Other companiesnamely Revive & Restorehave similar aims with other species, including the heath hen and passenger pigeon.

A proxy species isnt truly the old creature brought back to life. As described in a 2016 report by the International Union for Conservation of Natures Species Survival Commission, Proxy is used here to mean a substitute that would represent in some sense (e.g. phenotypically, behaviourally, ecologically) another entity the extinct form. The group added that Proxy is preferred to facsimile, which implies creation of an exact copy.

One expert who spoke to Gizmodo previously referred to the end-goals of these companies as something out of Lovecraft and the elephantine effort as a simulacrum that has no phylogenetic relationship with actual mammoths.

Its not just a question of having biological material from an extinct animal. Researchers exploring the possibility of resurrecting the Christmas Island rat found that some genetics were simply lost to time, in spite of the amount that could be gleaned from historic tissues and its nearest extant relatives. One member of the team told Gizmodo that We arent actually planning to do it, as probably the world doesnt need any more rats, and probably the money it would take to do the best job possible could be spent on better things, e.g., conserving living things. (That researcher is now a member of Colossals advisory board.) Nevertheless, the production of elephant iPSCs is a step toward producing these proxy animals, an aim that many scientists see as likely but fewer see as useful.

Once Colossal produces a herd of proxy mammoths, its intention is to decelerate the melting of the permafrost by loosing the animals on a swath of Siberia. Ultimately, Colossal says, the mammoth steppethe ancient ecosystem in which the giant proboscideans roamedcould be restored, helping fight climate change and pushing new technologies in gene editing in the process, helping extant elephants, which face their own survival threats.

But other technological breakthroughs will be necessary to make any of that possible. As noted by Nature, Church intends to use artificial elephant wombs to produce the proxy mammoths, so as to not require Asian elephant surrogates. Asian elephants are an endangered species; to use them as surrogates for proxy mammoths would be the cherry-on-top of an ethical dilemma sundae.

Were still a long way off from Colossals ultimate goals, but this recent achievement is a significant one, and a reminder that these de-extinction efforts involve serious science.

See the original post here:
Company Trying to Resurrect a Mammoth Makes a Stem Cell Breakthrough - Gizmodo

A low-cost device to make cell therapy safer – Tech Explorist

In cell therapy, clinicians reprogram some skin or blood cells from patients to create induced pluripotent stem cells. They coax these stem cells to transform into progenitor cells for treating spinal cord injury. These progenitors are then transplanted back into the patient to regenerate part of the injured spinal cord. However, pluripotent stem cells that dont entirely change into progenitors can form tumors.

Scientists at MIT and the Singapore-MIT Alliance for Research and Technology have developed a tiny device to improve cell therapy treatments with more excellent safety and effectiveness. They developed a microfluidic cell sorter to remove undifferentiated cells without damaging fully-formed progenitor cells.

This newly developed device can sort more than 3 million cells per minute without special chemicals. In the study, scientists found that combining many devices can sort more than 500 million cells per minute.

Pluripotent stem cells were generally larger than the progenitor cells derived from them. It happens because pluripotent stem cells have many genes that havent been switched off in their nucleus. As these cells specialize in specific functions, they suppress many genes that are no longer required, hence shrinking the nucleus. The microfluidic device leverages this size difference to sort the cells.

The plastic chip contains tiny channels that create an inlet for cells to enter, a spiral pathway, and four outlets where cells of different sizes are collected. When cells pass through the spiral at high speeds, various forces, including centrifugal forces, push them around. These forces help gather the cells at a specific point in the fluid stream based on their size, effectively separating them into different outlets.

The researchers discovered they could enhance the sorters performance by running it twice. First, they operate it at a lower speed, causing more giant cells to stick to the walls while smaller cells are sorted out. Then, they run it faster to separate the larger cells.

The device works similarly to a centrifuge, but it doesnt need human intervention to collect the sorted cells.

The device could remove almost 50% of larger cells in one pass. Whats more, the device doesnt use any filtration. The limitations with filters are that they become clogged or break down over time so that a filter-free device can be used for much longer.

Having demonstrated success on a small scale, the researchers are now moving on to larger studies and animal models to determine if the purified cells work better when introduced into living organisms.

Journal Reference:

Read this article:
A low-cost device to make cell therapy safer - Tech Explorist

Scientists develop world’s first 3D-printed brain tissue that functions like human brain – WION

In a path-breaking scientific endeavour, researchers have created the worlds first 3D-printed brain tissue that behaves like a natural brain tissue. This is being considered a major leap towards the development of advanced solutions to neurological and neurodevelopmental disorders.

This will greatly aid research programmes for scientists specially focused on treatments for a broad range of neurological and neurodevelopmental disorders, such as Alzheimers and Parkinsons disease.

This could be a hugely powerful model to help us understand how brain cells and parts of the brain communicate in humans, Su-Chun Zhang, professor of neuroscience and neurology at UWMadisons Waisman Center, was quoted as saying by Neuroscience.

It could change the way we look at stem cell biology, neuroscience, and the pathogenesis of many neurological and psychiatric disorders, he added.

The 3D printer employed by scientists here ditched the traditional approach in favour of stacking layers horizontally. They situated brain cells, neurons grown from induced pluripotent stem cells, in a softer bio-ink gel than previous attempts had employed.

Watch:Are brain implants the future of computing?

The tissue still has enough structure to hold together but it is soft enough to allow the neurons to grow into each other and start talking to each other, Zhang added.

Yuanwei Yan, a scientist in Zhangs lab, said the tissues stayed relatively thin, which allowed the neurons to easily access oxygen and enough nutrients from the growth media.

The neurons communicate with each other, send signals and interact through neurotransmitters, and even form proper networks with support cells that were added to the printed tissue.

We printed the cerebral cortex and the striatum and what we found was quite striking, Zhang said. Even when we printed different cells belonging to different parts of the brain, they were still able to talk to each other in a very special and specific way, he added.

As per experts, the printing technique offers an advanced level of precision not seen in other approaches, including brain organoids, miniature organs used to study brains. The technique offers control over the types as well as arrangements of cells, with proper organisation and control.

This provides scientists with flexibility in their research endeavours, which paves the way for radical advancements in the field.

(With inputs from agencies)

View post:
Scientists develop world's first 3D-printed brain tissue that functions like human brain - WION

Effect of a retinoic acid analogue on BMP-driven pluripotent stem cell chondrogenesis | Scientific Reports – Nature.com

James, S. L. et al. Global, regional, and national incidence, prevalence, and years lived with disability for 354 Diseases and Injuries for 195 countries and territories, 19902017: A systematic analysis for the Global Burden of Disease Study 2017. Lancet 392(10159), 17891858 (2018).

Article Google Scholar

Zhang, W., Ouyang, H., Dass, C. R. & Xu, J. Current research on pharmacologic and regenerative therapies for osteoarthritis. Bone Res. 4(October 2015), 15040 (2016).

Article CAS PubMed PubMed Central Google Scholar

Yamanaka, S. Pluripotent stem cell-based cell therapyPromise and challenges. Cell Stem Cell 27(4), 523531 (2020).

Article CAS PubMed Google Scholar

Jevotovsky, D. S., Alfonso, A. R., Einhorn, T. A. & Chiu, E. S. Osteoarthritis and stem cell therapy in humans: A systematic review. Osteoarthr. Cartil. 26(6), 711729 (2018).

Article CAS Google Scholar

Craft, A. M. et al. Generation of articular chondrocytes from human pluripotent stem cells. Nat. Biotechnol. 33(6), 638645 (2015).

Article CAS PubMed Google Scholar

Smith, C. A. et al. Directed differentiation of hPSCs through a simplified lateral plate mesoderm protocol for generation of articular cartilage progenitors. PLoS One 18(1), e0280024 (2023).

Article CAS PubMed PubMed Central Google Scholar

Loh, K. M. M. et al. Mapping the pairwise choices leading from pluripotency to human bone, heart, and other mesoderm cell types. Cell 166(2), 451467 (2016).

Article CAS PubMed PubMed Central Google Scholar

Chijimatsu, R. & Saito, T. Mechanisms of synovial joint and articular cartilage development. Cell. Mol. Life Sci. 76(20), 39393952 (2019).

Article CAS PubMed Google Scholar

Humphreys, P. A. et al. Developmental principles informing human pluripotent stem cell differentiation to cartilage and bone. Semin. Cell Dev. Biol. 127(July 2021), 1736 (2022).

Article CAS PubMed Google Scholar

Sumi, T., Tsuneyoshi, N., Nakatsuji, N. & Suemori, H. Defining early lineage specification of human embryonic stem cells by the orchestrated balance canonical Wnt/-catenin, activin/Nodal and BMP signaling. Development 135(17), 29692979 (2008).

Article CAS PubMed Google Scholar

Row, R. H. et al. BMP and FGF signaling interact to pattern mesoderm by controlling basic helix-loop-helix transcription factor activity. Elife 7, 127 (2018).

Article Google Scholar

Pignatti, E., Zeller, R. & Zuniga, A. To BMP or not to BMP during vertebrate limb bud development. Semin. Cell Dev. Biol. 32, 119127 (2014).

Article CAS PubMed Google Scholar

Ray, A., Singh, P. N. P., Sohaskey, M. L., Harland, R. M. & Bandyopadhyay, A. Precise spatial restriction of BMP signaling is essential for articular cartilage differentiation. Development 142(6), 11691179 (2015).

Article CAS PubMed PubMed Central Google Scholar

Kobayashi, T., Lyons, K. M., McMahon, A. P. & Kronenberg, H. M. BMP signaling stimulates cellular differentiation at multiple steps during cartilage development. Proc. Natl. Acad. Sci. U. S. A. 102(50), 1802318027 (2005).

Article CAS PubMed PubMed Central Google Scholar

Yoon, B. S. & Lyons, K. M. Multiple functions of BMPs in chondrogenesis. J. Cell. Biochem. 93(1), 93103 (2004).

Article CAS PubMed Google Scholar

Oldershaw, R. A. et al. Directed differentiation of human embryonic stem cells toward chondrocytes. Nat. Biotechnol. 28(11), 11871194 (2010).

Article CAS PubMed Google Scholar

Wang, T. et al. Enhanced chondrogenesis from human embryonic stem cells. Stem Cell Res. 39(May), 101497 (2019).

Article CAS PubMed PubMed Central Google Scholar

Diederichs, S., Klampfleuthner, F. A. M., Moradi, B. & Richter, W. Chondral differentiation of induced pluripotent stem cells without progression into the endochondral pathway. Front. Cell Dev. Biol. 7(November), 110 (2019).

Google Scholar

Kawata, M. et al. Simple and robust differentiation of human pluripotent stem cells toward chondrocytes by two small-molecule compounds. Stem Cell Rep. 13(3), 530544 (2019).

Article CAS Google Scholar

Weston, A. D., Chandraratna, R. A. S., Torchia, J. & Underhill, T. M. Requirement for RAR-mediated gene repression in skeletal progenitor differentiation. J. Cell Biol. 158(1), 3951 (2002).

Article CAS PubMed PubMed Central Google Scholar

Pacifici, M., Cossu, G., Molinaro, M. & Tato, F. Vitamin A inhibits chondrogenesis but not myogenesis. Exp. Cell Res. 129(2), 469474 (1980).

Article CAS PubMed Google Scholar

Hoffman, L. M. et al. BMP action in skeletogenesis involves attenuation of retinoid signaling. J. Cell Biol. 174(1), 101113 (2006).

Article CAS PubMed PubMed Central Google Scholar

Langston, A. W. & Gudas, L. J. Retinoic acid and homeobox gene regulation. Curr. Opin. Genet. Dev. 4(4), 550555 (1994).

Article CAS PubMed Google Scholar

Boncinelli, E., Simeone, A., Acampora, D. & Mavilio, F. HOX gene activation by retinoic acid. Trends Genet. 7(10), 329334 (1991).

Article CAS PubMed Google Scholar

Bel-Vialar, S., Itasaki, N. & Krumlauf, R. Initiating Hox gene expression: In the early chick neural tube differential sensitivity to FGF and RA signaling subdivides the HoxB genes in two distinct groups. Development 129(22), 51035115 (2002).

Article CAS PubMed Google Scholar

Shen, P. et al. Rapid induction and long-term self-renewal of neural crest-derived ectodermal chondrogenic cells from hPSCs. npj Regen. Med. 7(1), 115 (2022).

Article CAS Google Scholar

Xu, S. C., Harris, M. A., Rubenstein, J. L. R., Mundy, G. R. & Harris, S. E. Bone morphogenetic protein-2 (BMP-2) signaling to the Col21 gene in chondroblasts requires the homeobox gene Dlx-2. DNA Cell Biol. 20(6), 359365 (2001).

Article CAS PubMed Google Scholar

Lafont, J. E., Poujade, F. A., Pasdeloup, M., Neyret, P. & Mallein-Gerin, F. Hypoxia potentiates the BMP-2 driven COL2A1 stimulation in human articular chondrocytes via p38 MAPK. Osteoarthr. Cartil. 24(5), 856867 (2016).

Article CAS Google Scholar

Fernndez-Lloris, R. et al. Induction of the Sry-related factor SOX6 contributes to bone morphogenetic protein-2- induced chondroblastic differentiation of C3H10T1/2 cells. Mol. Endocrinol. 17(7), 13321343 (2003).

Article PubMed Google Scholar

Kim, H. S., Neugebauer, J., Mcknite, A., Tilak, A. & Christian, J. L. BMP7 functions predominantly as a heterodimer with BMP2 or BMP4 during mammalian embryogenesis. 122 (2019).

James, R. G. & Schultheiss, T. M. Bmp signaling promotes intermediate mesoderm gene expression in a dose-dependent, cell-autonomous and translation-dependent manner. Dev. Biol. 288(1), 113125 (2005).

Article CAS PubMed Google Scholar

Huang, D., Li, J., Hu, F., Xia, C., Weng, Q., Wang, T. et al. Lateral plate mesoderm cell-based organoid system for NK cell regeneration from human pluripotent stem cells. Cell Discov. 8(1) (2022).

Xi, H. et al. In vivo human somitogenesis guides somite development from hPSCs. Cell Rep. 18(6), 15731585 (2017).

Article CAS PubMed PubMed Central Google Scholar

Wu, C. L. et al. Single cell transcriptomic analysis of human pluripotent stem cell chondrogenesis. Nat. Commun. 12(1), 362 (2021).

Article CAS PubMed PubMed Central Google Scholar

Umeda, K. et al. Human chondrogenic paraxial mesoderm, directed specification and prospective isolation from pluripotent stem cells. Sci. Rep. 2(455), 111 (2012).

Google Scholar

Araoka, T., Mae, S. I., Kurose, Y., Uesugi, M., Ohta, A., Yamanaka, S. et al. Efficient and rapid induction of human iPSCs/ESCs into nephrogenic intermediate mesoderm using small molecule-based differentiation methods. PLoS One, 9(1), epub (114) (2014).

Zhang, P. et al. Short-term BMP-4 treatment initiates mesoderm induction in human embryonic stem cells. Blood 111(4), 19331941 (2008).

Article CAS PubMed Google Scholar

Winnier, G., Blessing, M., Labosky, P. A. & Hogan, B. L. M. Bone morphogenetic protein-4 is required for mesoderm formation and patterning in the mouse. Genes Dev. 9(17), 21052116 (1995).

Article CAS PubMed Google Scholar

Chalamalasetty, R. B. et al. Mesogenin 1 is a master regulator of paraxial presomitic mesoderm differentiation. Development 141(22), 42854297 (2014).

Article CAS PubMed PubMed Central Google Scholar

Chapman, D. L., Agulnik, I., Hancock, S., Silver, L. M. & Papaioannou, V. E. Tbx6, a mouse T-box gene implicated in paraxial mesoderm formation at gastrulation. Dev. Biol. 180(2), 534542 (1996).

Article CAS PubMed Google Scholar

Kashyap, V. & Gudas, L. J. Epigenetic regulatory mechanisms distinguish retinoic acid-mediated transcriptional responses in stem cells and fibroblasts. J. Biol. Chem. 285(19), 1453414548 (2010).

Article CAS PubMed PubMed Central Google Scholar

Cheng, A. et al. Cartilage repair using human embryonic stem cell-derived chondroprogenitors. Stem Cells Transl. Med. 3(11), 12871294 (2014).

Article CAS PubMed PubMed Central Google Scholar

Wang, L. et al. Activin/Smad2-induced histone H3 Lys-27 trimethylation (H3K27me3) reduction is crucial to initiate mesendoderm differentiation of human embryonic stem cells. J. Biol. Chem. 292(4), 13391350 (2017).

Article CAS PubMed Google Scholar

Fowler, D. A. & Larsson, H. C. E. The tissues and regulatory pattern of limb chondrogenesis. Dev. Biol. 463(2), 124134 (2020).

Article CAS PubMed Google Scholar

Waxman, J. S., Keegan, B. R., Roberts, R. W., Poss, K. D. & Yelon, D. Hoxb5b acts downstream of retinoic acid signaling in the forelimb field to restrict heart field potential in zebrafish. Dev. Cell 15(6), 923934 (2008).

Article CAS PubMed PubMed Central Google Scholar

Feneck, E. & Logan, M. The role of retinoic acid in establishing the early limb bud. Biomolecules 10(2) (2020).

Cunningham, T. J. & Duester, G. Mechanisms of retinoic acid signalling and its roles in organ and limb development. Nat. Rev. Mol. Cell Biol. 16(2), 110123 (2015).

Article CAS PubMed PubMed Central Google Scholar

Nishimoto, S., Wilde, S. M., Wood, S. & Logan, M. P. O. RA acts in a coherent feed-forward mechanism with Tbx5 to control limb bud induction and initiation. Cell Rep. 12(5), 879891 (2015).

Article CAS PubMed PubMed Central Google Scholar

Jepsen, K. et al. Combinatorial roles of the nuclear receptor corepressor in transcription and development. Cell 102(6), 753763 (2000).

Article CAS PubMed Google Scholar

Simeone, A., Acampora, D., Arcioni, L., Andrews, P. W., Boncinelli, E. & Mavilio, F. Sequential activation of HOX2 homeobox genes by retinoic acid in human embryonal carcinoma cells. Nat. 1990 3466286, 346(6286), 763766 (1990).

Kmita, M. & Duboule, D. Organizing axes in time and space; 25 years of colinear tinkering. Science (80-.) 301(5631), 331333 (2003).

Article CAS Google Scholar

Papalopulu, N., Lovel-badage, R. & Krumlauf, R. The expression of murine Hox-2 genes is dependent on the differentiation pathway and displays a collinear sensitivity to retinoic acid in F9 cells and Xenopus embryos. Nucleic Acids Res. 19(20), 5497 (1991).

Article CAS PubMed PubMed Central Google Scholar

De, K. B. et al. Analysis of dynamic changes in retinoid-induced transcription and epigenetic profiles of murine Hox clusters in ES cells. Genome Res. 25(8), 12291243 (2015).

Visit link:
Effect of a retinoic acid analogue on BMP-driven pluripotent stem cell chondrogenesis | Scientific Reports - Nature.com

An epigenetic barrier sets the timing of human neuronal maturation – Nature.com

PSC lines and cell culture

Experiments with hPSCs and iPSCss was approved in compliance with the Tri-Institutional ESCRO at Memorial Sloan Kettering Cancer Center, Rockefeller University and Weill Cornell Medicine. hPSC lines WA09 (H9; 46XX) and WA01 (H1; 46XY) were from WiCell Stemcell Bank. The GPI::Cas9 line was derived from WA09 hPSCs. MSK-SRF001 iPSCs were from Memorial Sloan Kettering Cancer Center. hPSCs and iPSCs were authenticated by STR. hPSCs and iPSCs were maintained with Essential 8 medium (Life Technologies A1517001) in feeder-free conditions onto vitronectin-coated dishes (VTN-N, Thermo Fisher A14700). hPSCs and iPSCs were passaged as clumps every 45 days with EDTA (0.5M EDTA/PBS) and routinely tested for mycoplasma contamination. The GPI::Cas9 knock-in hPSCline was generated using CRISPRCas9-mediated homologous recombination by transfecting H9 hPSCs with the Cas9-T2A-Puro targeting cassette downstream of the GPI gene (Supplementary Fig. 6b). Selected clones were validated by genomic PCR and Cas9 mRNA and protein expression by RTqPCR and western blot, respectively and screened for Karyotype banding. CHD5-KO and JADE2-KO WA09 hPSC lines were generated by the SKI Stem Cell Research Core at Memorial Sloan Kettering Cancer Center (MSKCC) via CRISPRCas9 using the following gRNA targets: CHD5, CGTGGACTACCTGTTCTCGG; JADE2, CAGTTTGGAGCATCTTGATG. Mouseepiblast stem cells (EpiSCs) B6.129_4 were a gift from the Vierbuchen laboratory at Memorial Sloan Kettering Cancer Center and were maintained on mouse embryonic fibroblasts as previously described64. Rat primary astrocytes were purchased from Lonza (R-CXAS-520) and cultured according to manufacturer instructions.

hPSCs (passage 4050) were differentiated toward cortical excitatory neurons using an optimized protocol based on dual SMAD inhibition and WNT inhibition as follows. hPSCss were dissociated at single cells using Accutase and plated at 300,000 cells per cm2 onto Matrigel-coated wells (354234, Corning) in Essential 8 medium supplemented with 10M Y-27632. On day 02, cells were fed daily by complete medium exchange with Essential 6 medium (E6, A1516401, Thermo Fisher Scientific) in the presence of 100nM LDN193189 (72142, Stem Cell Technologies), 10M SB431542 (1614, Tocris) and 2M XAV939 (3748, Tocris) to induce anterior neuroectodermal patterning. On day 39 cells were fed daily with Essential 6 medium (E6, A1516401, Thermo Fisher Scientific) in the presence of 100nM LDN193189 (72142, Stem Cell Technologies), 10M SB431542. On day 1020 cells were fed daily with N2/B27 medium (1:1 NB:DMEM/F12 basal medium supplemented with 1 N2 and B27 minus vitamin A) to generate a neurogenic population of cortical NPCs. N2 and B27 supplements were from Thermo. At day 20, NPCs were either cryopreserved in STEM-CELLBANKER solution (Amsbio) or induced for synchronized neurogenesis as following: NPCs were dissociated at single cells following 45min incubation with Accutase and seeded at 150,000 cells per cm2 onto poly-l-ornithine and laminin/ fibronectin-coated plates in NB/B27 medium (1 B27 minus vitamin A, 1% l-glutamine and 1% penicillin-streptomycin in Neurobasal medium) in the presence of 10M Notch pathway inhibitor DAPT for 10 days (until day30). For long-term culture, neurons were maintained in NB/B27 supplemented with BDNF (450-10, PreproTech), GDNF (248-BD-025, R&D biosystems), cAMP (D0627, Sigma) and ascorbic acid (4034-100, Sigma). From day 20 onwards, cells were fed every 45 daysby replacing 50%of the mediumvolume. For neurons-astrocytes co-cultures, rat primary astrocytes were plated onto poly-l-ornithine and laminin/fibronectin-coated plates in NB/B27 medium supplemented with BDNF, GDNF, cAMP and ascorbic acid and allowed to adhere for few days. hPSC-derived neurons at day 25 were dissociated using Accutase and seeded on top of rat astrocytes. Neurons-astrocytes co-cultures were maintained on NB/B27 medium supplemented with BDNF, GDNF, cAMP and ascorbic acid.

Mouse epiblast stem cells (mEpiSCs) B6.129_4 were differentiated as following: on day 0, mEpiSC colonies were lifted from feeders using 0.5Ul1 collagenase IV in HBSS++, dissociated to single-cell solution using Accutase, then plated at 220,000 cells per cm2 on Matrigel-coated wells in mN2/B27 media64 supplemented with 10M Y-27632, 100nM LDN193189, 10M SB431542 and 2M XAV939. Cells were fed daily with mN2/B27 supplemented with 2M XAV939 (day 1), 100nM LDN193189 (day 15), 10M SB431542 (day 15). On day 6 NPCs were dissociated to single-cell suspension using Accutase and replated at 200,000 cells per cm2 onto poly-l-ornithine and laminin/fibronectin-coated plates in NB/B27 medium (10% Neurobasal, 90% Neurobasal A, 1 B27 minus vitamin A, 1% Glutamax, 0.5% penicillin-streptomycin, 0.1% BDNF, 0.1% cAMP, 0.1% ascorbicacid, 0.1% GDNF) supplemented with 10M Y-27632 (day 6) and 10M DAPT (day 6 and 8). Cells were fed every other day by replacing 50% of the medium volume.

On day 1, WA09 (H9) hPSCs were dissociated with EDTA for 10min at 37C and allowed to aggregate into spheroids of 10,000 cells each in V-bottom 96 well microplates (S-Bio) in E8 medium with ROCK inhibitor (Y-27632, 10M) and WNT inhibitor (XAV939, 5M, Tocris 3748). The next day (day 0), the medium was changed to E6 supplemented 100nM LDN193189, 10M SB431542 and 5M XAV939. On day 5, medium was switched to E6 supplemented with 100nM LDN193189, 10M SB431542. On day 8, medium was changed to N2/B27-based organoid medium as previously described65. From day 0 to day 14 medium was replaced every other day. On day 14, organoids were transferred to an orbital shaker on 10cm dishes and half of the medium was changed on a MondayWednesdayFriday schedule. Treatment with 4M GSK343 or DMSO was performed transiently from day 1725 or day 1737 depending on the experiment as indicated in the figures.

For birth-dating experiments of WA09 (H9) hPSC-derived cortical neurons, 3M EdU (5-ethynyl-2-deoxyuridine, A10044 Invitrogen) was added to the culture for 48h in the following time windows: d1819, d2021, d2223, d2425, d2627, d2829. After treatment, EdU was washed out and neurons were fixed at day40 of differentiation and processed for immunostaining. Treatment of hPSC-derived cortical NPCs with small molecules inhibitors of chromatin regulator was performed from day12 to day20 of differentiation (Fig. 4b). Small molecules were washed out and withdrawn starting at day 20 before the induction of synchronized neurogenesis and neurons derived from all the treatments were maintained in the same conditions. Small molecules were dissolved in DMSO and added to the N2/B27 medium at 2 or 4 M depending on the experiment. DMSO in control conditions was added at the corresponding dilution factor as for epigenetic inhibitors.

Treatment of mEpiSC-derived NPCs was performed as follows: For Ezh2i experiments, 0.04% DMSO or 4M GSK343 was added to NPC medium on day 4 and 5. For Ezh2i+ experiments this treatment was extended with 0.02% DMSO or 2M GSK343 being added to medium on day 6, 8 and 10. GSK-J4 was used at 1 M and added to the medium on day 4 and 5.

The following small molecules targeting epigenetic factors were used in the study and purchased from MedChemExpress: GSK343 (HY-13500), UNC0638 (HY-15273), EPZ004777 (HY-15227), GSK2879552 (HY-18632), CPI-455 (HY-100421), A-196 (HY-100201), GSK-J4 (HY-15648F). A List of small molecules and relative molecular target is reported in Extended Data Fig. 3b.

For the morphological reconstruction of WA09 (H9) hPSC-derived neurons, NPCs were infected at day20 with low-titre lentiviruses expressing dTomato reporter. Following induction of neurogenesis, the resulting neurons were fixed at day 25, 50, 75 and 100. The dTomato reporter signal was amplified by immunofluorescence staining and individual neurons were imaged at Zeiss AXIO Observer 7 epi-fluorescence microscope at 10 magnification. Neuronal morphology was reconstructed in Imaris v9.9.1 software using the filamentTracer function in autopath mode and using the nucleus (using DAPI channel) as starting point. Traces were eventually manually corrected for accuracy of cell processes detection. Neurite length and Sholl Analysis (every 10 m radius) measurements were performed in the Imaris platform and extracted for quantifications and statistics. For staining with synaptic markers, cells were cultured on -plate 96 Well Black (Ibidi) and stained for SYN1 and PSD95 antibodies to visualize pre and post -synaptic puncta respectively and MAP2 to visualize neuronal dendrites. Confocal images were acquired using a 63 immersion objective at a Leica SP8WLL confocal laser-scanning microscope. Three fields of view for each sample from two independent differentiations (total of 6 fields of viewpercondition) were analysed as following. Single-plane confocal images were open in Fiji v2.9.0 and puncta were detected using the SynQuant plugin (https://github.com/yu-lab-vt/SynQuant). The z-score for particle detection was adjusted for accuracy of puncta detection. The other parameters were set as default value. Dendrite length was extracted from the reference MAP2 channel.

Cultured cells were fixed with 4% PFA in PBS for 20min at RT, washed three times with PBS, permeabilized for 30min in 0.5% Triton X-100 in PBS and then blocked in a solution containing 5% Normal goat serum or Normal donkey serum, 2% BSA and 0.25% Triton X-100 for 1h at room temperature. Primary antibodies were incubated overnight at 4Cin the same blockingsolution. EdU+ cells were detected using the Click-iT EdU Imaging kit (Molecular Probes) with Alexa Fluor 488 according to manufacturers instructions. Secondary antibodies conjugated to either Alexa 488, Alexa 555 or Alexa 647 (Thermo) were incubated for 45min at 1:400 dilutionin blocking solution. Cell nuclei were stained with 5M 4-6-diamidino-2-phenylindole (DAPI) in PBS.

Organoids were fixed in 4% PFA overnight at 4C, washed 3 times with PBS and cryoprotected in 30% sucrose/PBS. Organoid tissue was sectioned at 30m on a cryostat (Leica 3050S), mounted on microscope slides, allowed to dry at room temperature and stored at 80C. On the day of the staining, slides we defrosted for 20min at room temperature. Sections were first permeabilized in 0.5% Triton X-100 in PBS, blocked for 1h in 5% normal goat serum, 1% BSA, 0.25% triton in PBS and incubated in the same solution with primary antibodies overnight. The next day, sections were washed with PBS and incubated in secondary antibodies for 2.5h at room temperature at 1:400 dilution. DAPI 5M stain was used to identify cell nuclei. Images were captured using a Leica SP8WLL confocal laser-scanning microscope.

The following primary antibodies and dilutions were used: rabbit anti-PAX6 1:300 (901301, Biolegend); rabbit anti-FOXG1 1:500 (M227, Clonetech); mouse anti-Nestin 1:400 (M015012, Neuromics); mouse anti-MAP2 1:200 (M1406, Sigma); chicken anti-MAP2 1:2000 (ab5392, Abcam); rabbit anti-class III -tubulin (TUJI) 1:1,000 (MRB-435P, Covance); mouse anti-Ki67 1:200 (M7240, Dako); rabbit anti-Ki67 1:500 (RM-9106, Thermo Scientific); rabbit anti-TBR1 1:300 (ab183032, Abcam); rabbit anti-TBR1 1:500 (ab31940, Abcam); rat anti-CTIP2 1:500 (ab18465, Abcam); mouse anti-SATB2 1:1,000 (ab51502, Abcam); rabbit anti-synapsin I 1:1,000 (S193, Sigma); mouse anti-PSD95 1:500 (MA1-046, Thermo); mouse anti-neurofilament H 1:500 (non-phosphorylated) (SMI32, Enzo Life science); mouse anti c-FOS 1:500 (ab208942, Abcam); mouse anti-HLA Class I ABC 1:150 (ab70328, abcam); goat anti-RFP 1:1,000 (200-101-379, Rockland); rabbit anti-DsRed 1:750 (632496, Clontech); rabbit anti-H3K27me3 1:200 (9733, Cell Signaling Technologies); rabbit anti-GFAP 1:500 (Z033429-2, Dako); chicken anti-GFP 1:1,000 (ab13970, Abcam); rat anti-SOX2 1:200 (14-9811-82, Thermo); rabbit anti-AQP4 1:500 (HPA014784, SIGMA); sheep anti-EOMES 1:200 (AF6166, R&D). The primary antibodies including anti-GFAP antibody were validated for recognition of human antigens to confirm lack of human astrocytes in our synchronized cortical cultures.

smRNA-FISH was performed on WA09 (H9) hPSC-derived and mEpiSC-derived neurons using ViewRNA Cell Plus Assay Kit (Invitrogen) in RNAse-free conditions according to manufacturers instructions to simultaneously detect RNA targets by in situ hybridization and the neuronal marker MAP2 (Alexa Fluor 647) by immunolabelling. Neurons were plated on -plate 24 Well Black (Ibidi) plates, fixed and permeabilized for 15min at room temperature with fixation/permeabilization solution and blocked for 20min followed by incubation with primary and secondary antibody for 1h at room temperature. Target probe hybridization with mouse or human -specific viewRNA Cell Plus probe sets was carried at 40C under gentle agitation for 2h. Type 1 (Alexa Fluor 546) and type 4 (Alexa Fluor 488) probe sets were used to detect EZH2 and TBP RNA respectively, using the same fluorophore scheme for neurons derivedfrom mEpiSCs and hPSCs. Pre amplification, amplification and fluorescence labelling steps were carried at 40C under gentle agitation for 1h each. Washes were performed as indicated in the kits procedure. Samples were incubated with 5M DAPI to visualize cell nuclei and a coverslip was gently placed inside each well using ProLong Glass Antifade Mountant. z-stack images at 0.4 m step and covering the entire cell volume were acquired using a Leica SP8WLL confocal laser-scanning microscope with a 63 immersion objective at 3 digital zoom. z-stacks were loaded and projected in Imaris v9.9.1 software for RNA puncta visualization and quantification within each single MAP2 positive neuron. Eight different fields of view (25 neurons per field) for each condition (mouse versus human) from two independent batches of differentiations (16 fields of view per condition) were obtained for downstream analysis. The nuclear volume for each neuron was reconstructed and calculated using the Surface function in Imaris Software.

For electrophysiological recordings, neurons were plated in 35mm dishes. Whole-cell patch clamp recordings during the maturation time course were performed at day 25, 50, 75 and 100 of differentiation as previously described22. In brief, neurons were visualized using a Zeiss microscope (Axioscope) fitted with 4 objective and 40 water-immersion objectives. Recordings were performed at 2324C and neurons were perfused with freshly prepared artificial cerebral-spinal fluid (aCSF) extracellular solution saturated with 95% O2, 5% CO2 that contained (in mM): 126 NaCl, 26 NaHCO3, 3.6 KCl, 1.2 NaH2PO4, 1.5 MgCl2, 2.5 CaCl2, and 10 glucose. Pipette solution for recordings in current clamp configuration contained (in mM): 136 KCl, 5 NaCl, 5 HEPES, 0.5 EGTA, 3 Mg-ATP, 0.2 Na-GTP, and 10 Na2-phosphocreatine, pH adjusted to 7.3 with KOH, with an osmolarity of ~290mOsm. For mEPSCs, the pipette solution contained (in mM): 140 CsCl, 10 NaCl, 10 HEPES, 0.5 EGTA, 3 Mg-ATP, 0.2 Na-GTP, and 10 Na2-phosphocreatine, pH adjusted to 7.3 with CsOH. 20M ()-bicuculline methochloride (Tocris), 1M strychnine HCl (Sigma), and 0.5M tetrodotoxin (TTX) (Alomone Labs) were added to aCSF for mEPSC recordings to block GABAA receptors, glycine receptors, and voltage-gated Na+ channels, respectively. Input resistance was measured from a voltage response elicited by intracellular injection of a current pulse (100 pA, 200ms). Membrane voltage was low-pass filtered at 5kHz and digitized at 10kHz using a Multiclamp 700B amplifier connected to a DigiData 1322A interface (Axon Instruments) using Clampex 10.2 software (Molecular Devices). Liquid junction potentials were calculated and corrected off-line. Action potentials were generated in current clamp from currents injected in 10 pA intervals from 0 to 250 pA. Recordings were analysed for: resting membrane potential, input resistance, rheobase, threshold, as well as action potential amplitude, overshoot, duration, half-width, rise and decay. Neurons were held at 80mV and continuous recordings of mEPSCs were made using Axoscope software (Molecular Devices). Data processing and analysis were performed using MiniAnalysis (Synaptosoft) version 6 and Clampfit 10.2 (Molecular Devices). Events were detected by setting the threshold value, followed by visual confirmation of mEPSC detection. Whole-cell patch clamp recordings in neurons derived from DMSO and EZH2i conditions (pipettes 36 M) were performed in aCSF containing (in mM): 125 NaCl, 2.5 KCl, 1.2 NaH2PO4, 1 MgSO4, 2 CaCl2, 25 NaHCO3 and 10 d-glucose. pH and osmolarity were adjusted to 7.4 and 300310mOsm, respectively. For firing recordings, pipettes were filled with a solution containing (in mM): 130 potassium gluconate, 4 KCl, 0.3 EGTA, 10 Na2-phosphocreatine, 10 HEPES, 4 Mg2-ATP, 0.3 Na2-GTP and 13 biocytin. pH and osmolarity were adjusted to 7.3 (with KOH) and 285290mOsm respectively. For mEPSCs recordings the ACSF was supplemented with 1M TTX and 100M 4-AP and pipettes were filled with a caesium-based solution that contained (in mM): 120 CsMeSO4, 8 NaCl, 10 HEPES, 0.3 EGTA, 10 TEA-Cl, 2 Mg2-ATP, 0.3 Na2-GTP, 13.4 biocytin and 3 QX-314-Cl. pH: 7.3 (adjusted with CsOH) and 290295mOsm. Recordings were acquired with a computer-controlled Multiclamp 700B amplifier and a Digidata 1550B (Molecular Devices, California) at a sampling rate of 10kHz and low-pass filtered at 1kHz. pClamp 10 software suite (Molecular Devices) was used for data acquisition (Clampex 10.6) and data analysis (Clampfit 10.6). The quantification of the amplitude and inter-event interval of mEPSCs shown in the cumulative probability plots in Fig. 4j was performed taking all the events together. To isolate the NMDA component from mEPSCs recorded at +40mV, we measured current amplitude 20ms after the mEPSC onset, where AMPA receptors are desensitized (depicted by the dotted line in Extended Data Fig. 5f)66,67,68. For the calculation of the NMDA/AMPA ratio, the amplitude of the NMDA component was then divided by the amplitude of the peak of the AMPA currents recorded at 70mV. Statistical analysis and plots were done in Prism 9 (GraphPad, California). Evoked action potential and traces shown in DMSO versus EZH2i groups in Fig. 4g were elicited with 20 pA injected current.

hPSC-derived cortical neurons were infected with lentiviruses encoding GCaMP6m and cultured on -plate 96 Well Black (Ibidi). In rat astrocytes co-culture experiments, hPSC-derived neurons were infected with GCaMP6m lentiviruses four days before dissociation and prior to seeding onto rat primary astrocytes. For each batch of experiments, the infection and measurement of Ca2+ spikes in neurons under control or genetic/pharmacological perturbation has been done in parallel on the same day to account for the variability in the absolute expression of GCaMP6m due to lentiviral delivery. Ca2+ imaging was performed as previously described69. In brief, on the day of the imaging, cells were gently washed twice in modified Tyrode solution (25mM HEPES (Invitrogen), 140mM NaCl, 5mM KCl, 1mM MgCl2, 10mM glucose, 2mM CaCl2, 10M glycine, 0.1% BSA pH 7.4, pre-warmed to 37C) and equilibrated in imaging buffer for 1-2min (25mM HEPES, 140mM NaCl, 8mM KCl, 1mM MgCl2, 10mM glucose, 4mM CaCl2, 10M glycine, 0.1% BSA pH 7.4, pre-warmed to 37C). GCaMP6m fluorescence was recorded on Celldiscover7 (ZEISS) inverted epi-fluorescence microscope with the 488nm filter under environmental control (37C; 95% O2, 5% CO2) using ZEN Blue 3.1 software at the Bio-Imaging Resource Center (BIRC) at Rockefeller University. Neuronal cultures were imaged for ~3min at a frame rate of 46 frames per second (600800 frames per time lapse) using a 10 or 20 objective.

hPSC-derived cortical brain organoids were infected with lentiviruses encoding GCaMP6m at day 45 of differentiation and cultured in BrainPhys Imaging Optimized Medium (Stem Cell Technologies) for a week before the imaging. On the day of the imaging, DMSO control and organoids transiently treated with GSK343 were equilibrated in imaging buffer for 30min and transferred into imaging cuvettes. GCaMP6m fluorescence on intact organoids was recorded by light-sheet microscopy on TruLive3D Imager (Bruker) under environmental control (37C; 95% O2 5% CO2). Multiple fields of view from 34 organoids per condition from 2 independent batches each were imaged for ~24min at a frame rate of 510 frames per second at 31.3 effective magnification.

Analysis was performed as previously described69. In brief, the live-imaging image stack was converted to TIFF format and loaded into optimized scripts in MATLAB (Mathworks) R2020b and R2021b. Region of Interest (ROI) were placed on the neuron somas to calculate the raw GCaMP6m intensity of each neuron over time. The signal intensity of each raw trace was normalized to baseline fluorescence levels (F/F0) for spike detection. Single-neuron amplitude was calculated from the normalized GCaMp6m intensity for all the detected spikes in each trace (mean F/F0 of detected spikes for each neuron). Single-neuron frequency was calculated as the number of detected spikes in each trace per minute of recording. Network activity was assessed by calculating the synchronous firing rate, defined as the number of detected synchronous Ca2+ spikes from all ROI in one FOV per minute of recording. In Figs. 1k and 4k, coloured lines depict the normalized (F/F0) GCaMP6m signal traces of individual neurons in 1 field of view during 1min of imaging; the black line is the averaged normalized GCaMP6m signal among neurons in 1 field of view. Images in Figs. 1j Fig. 4m were displayed as royal lookup table in FIJI. Supplementary Videos16 show 20 frames per second, Supplementary Videos7 and 8 show 100 frames per second.

Microscopy images were visualized with Adobe Photoshop 2022, Fiji 2.9.0 or Imaris software version 9.9.1. Morphological reconstruction of neurons was performed using Imaris software version 9.9.1. Ca2+ imaging analysis was performed using MATLAB software. Quantification of immunofluorescence images was performed in FIJI (ImageJ) version 2.9.0 or using the Operetta high content imaging system coupled with Harmony software version 4.1 (PerkinElmer).

Cells were collected and lysed in RIPA buffer (Sigma) with 1:100 Halt Protease and Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific) and then sonicated for 330sec at 4C. Protein lysates were centrifugated for 15min at more than 15,000rpm at 4C and supernatant was collected and quantified by Precision Red Advanced Protein Assay (Cytoskeleton). 510g of protein were boiled in NuPAGE LDS sample buffer (Invitrogen) at 95C for 5min and separated using NuPAGE 412% Bis-Tris Protein Gel (Invitrogen) in NuPAGE MES SDS Running Buffer (Invitrogen). Proteins were electrophoretically transferred to nitrocellulose membranes (Thermo Fisher Scientific) with NuPAGE Transfer Buffer (Invitrogen). Blots were blocked for 60min at room temperature in TBS-T+5% nonfat milk (Cell Signaling) and incubated overnight in the same solution with the respective primary antibodies at 4C. The following primary antibodies were used: mouse anti-neurofilament H 1:500 (non-phosphorylated) (SMI32; Enzo Life science); mouse anti-syntaxin 1A 1:500 (110 111; SYSY); mouse anti-actin 1:500 (MAB1501; Millipore); mouse anti-Cas9 1:500 (14697; Cell Signaling Technology); rabbit anti-CHD3 1:1,000 (ab109195, Abcam); rabbit anti-KDM5B 1:1,000 (ab181089, abcam). The following secondary antibodies were incubated for 1h at room temperature at 1:1,000 dilution: anti-mouse IgG HRP-linked (7076; Cell Signaling Technology) and anti-rabbit IgG HRP-linked (7074; Cell Signaling Technology). Blots were revealed using SuperSignalTM West Femto Chemiluminescent Substrate (Thermo Fischer Scientific) at ChemiDoc XRS+ system (Bio-Rad). Chemiluminescence was imaged and analysed using Image lab software version 6.1.0 (Bio-Rad). Controls samples were run within each gel and the signal intensity of protein bands of interest was normalized to the intensity of the actin band (loading control) for each sample on the same blot. Uncropped and unprocessed images are shown in Supplementary Figure 1. One sample t-test on Fig. 3d was performed by comparing the mean of logFC for each genetic perturbation with the hypothetical mean logFC = 0 (null hypothesis of no changes). Two-tailed ratio-paired t-test in Fig. 4c was calculated on normalized marker/actin expression in manipulations versus DMSO.

Samples were collected in Trizol. Total RNA from hPSC-derived samples was isolated by chloroform phase separation using Phase Lock Gel-Heavy tubes, precipitated with ethanol, and purified using RNeasy Mini Kit (Qiagen) with on-column DNA digestion step. RNA from mouse cells was isolated using Direct-zol microprep kit (Zymo research, R2060). cDNA was generated using the iScript Reverse Transcription Supermix (Bio-Rad) for RTqPCR and quantitative PCR (qPCR) reactions were performed using SsoFast EvaGreen Supermix (Bio-Rad) according to the manufacturers instructions in 96 or 384-well qPCR plates using CFX96 and CFX384 Real-Time PCR Detection systems (Bio-Rad) using 510ng cDNA / reaction. Primers were from Quantitect Primer assays (QUIAGEN) except for the ones in Supplementary Table 4. Results were normalized to the housekeeping genes GAPDH or TBP.

A Cas9-T2A-PuroR cassette flanked by 5 and 3 homology arms for the GPI locus was generated by NEBuilder HiFi DNA Assembly Cloning Kit of PCR-amplified fragments according to manufacturers instruction. EF1alpha-GCaMP6m lentiviral vector was generated by PCR amplification of GCaMP6m from pGP-CMV-GCaMP6m (Addgene 40754) using with Q5 High Fidelity master mix (NEB) and subcloned into pWPXLd (Addgene 12258) into BamH1 and EcoRI restriction site using standard cloning methods. For the simultaneous expression of gene-specific gRNA under transcriptional control of U6 promoter and dTomato fluorescent reporter driven by EF1alpha promoter, the SGL40.EFs.dTomato vector (Addgene 89398) was modified by inserting a P2A-Basticidin cassette downstream of dTomato sequence to generate the SGL40.EFs.dTomato-Blast backbone. gRNA sequences specific to each gene were designed using SYNTEGO CRISPR design tool (https://www.synthego.com/products/bioinformatics/crispr-design-tool) and validated using CRISPOR tool70 (http://crispor.tefor.net). DNA oligos (IDT) were annealed and subcloned into BsmBI restriction sites of SGL40.EFs.dTomato-Blast lentiviral backbone by standard cloning methods. Lentiviruses were produced by transfection of HEK293T cells (ATCC) using the Xtreme Gene 9 DNA transfection reagent (Sigma) with the respective lentiviral vectors along with the packaging vectors psPAX2 (Addgene, 12260) and pMD2.G (Addgene, 12259). Arrayed CRISPR gRNA lentiviral libraries were produced simultaneously. Viruses were collected 48h post transfection, filtered with 0.22-m filters and stored in aliquots at 80C.The sequence of each gRNA used is reported in Supplementary Table 5.

Total RNA was extracted as described above. Sample for RNA-seq during chronological maturation at hPSC, NPC, d25, d50, d75 and d100 timepoints were submitted for TruSeq stranded ribo-depleted paired-end total RNA-seq at 4050 million reads at the Epigenomic Core at Well Cornell Medical College (WCMC). Samples for RNA-seq studies on neurons upon perturbation with epigenetic inhibitors were submitted for paired-end poly-A enriched RNA-seq at 2030 million reads to the MSKCC Integrated Genomic Core. Quality control of sequenced reads was performed by FastQC. Adapter-trimmed reads were mapped to the hg19 human genome using versions 2.5.0 or 2.7.10b of STAR71. The htseq-count function of the HTSeq Python package version 0.7.172 was used to count uniquely aligned reads at all exons of a gene. For the chronological maturation studies, the count values were transformed to RPKM to make them comparable across replicates. A threshold of 1 RPKM was used to consider a gene to be present in a sample and genes that were present in at least one sample were used for subsequent analyses. Differential gene expression across timepoints or treatments with epigenetic inhibitors was computed using versions 1.16 or 1.22.2 of DESeq2 respectively73. Variance stabilizing transformation of RNA-seq counts was used for the PCA plots and for heat maps of gene expression. For downstream analysis of trends of gene expression, transcripts were first grouped into monotonically upregulated and monotonically downregulated based on the characteristics of their expression from d25 to d100 and further categorized in strict: all the transitions satisfy the statistical significance criteria and relaxed: d25 versus d100 transition satisfy the significance criteria and intermediate transitions may not. For all comparisons a significance threshold of false discovery rate (FDR)5% was used. Monotonically upregulated (strict): (d50 versus d25: FDR5%) and (d100 versus d25: FDR5%) and (d100 versus d50: FDR5%) and (d50 versus d25:logFC > 0) and (d75 versus d50: logFC > 0) and (d100 versus d25 logFC > d50 versus d25 logFC). Monotonically downregulated (strict): (d50 versus d25:FDR5%) and (d100 versus d25: FDR5%) and (d100 versus d50: FDR5%) and (d50 versus d25:logFC <0) and (d75 versus d50: logFC <0) and (d100 versus d25 logFC 0) and ((d100 versus d25:logFC >= d50 versus d25: logFC) OR (d75 versus d50: logFC > 0)). Monotonically downregulated (relaxed): (d100 versus d25: FDR5%) and (d50 versus d25:logFC <0) and ((d100 versus d25:logFC <= d50 versus d25: logFC) OR (d75 versus d50: logFC <0)). GSEA74 was performed on d50 versus d25 and d100 versus d50 pairwise comparisons to test enrichment in KEGG pathways or gene sets from MSigDB using the following parameters: FDR5%, minimum gene-set size=15, maximum gene-set size=500, number of permutations = 1000. GO term analysis was performed using v6.8 DAVID75 (http://david.abcc.ncifcrf.gov/knowledgebase/). Venn diagrams were generated using Biovenn76.

The score for maturation in neurons upon epigenetic inhibition and control conditions (Extended Data Fig. 7b,c). was computed based on the geometric distribution of samples in the three-dimensional coordinate system defined by PCA1, 2 and 3. For each condition (treatment and day of differentiation), the coordinates defining the position of the samples in the 3D PCA space were determined based on the average across replicates. The DMSO d25 coordinates were set as the origin. The vectors defining maturation trajectories for each treatment and timepoint were then measured as the connecting segments between sample coordinates. The vector linking DMSO d25 and DMSO d50 conditions was used to define the chronological maturation trajectory and set as a reference (control vector) to calculate a similarity score for each treatment at any given timepoint. To account for vector magnitude and directionality, the dot product metric treatment vectorcontrol vector was used to calculate the scores. Gene expression correlation heat maps in Extended Data Fig7d were created from either all genes or maturation genes only by computing Pearson correlation and then running agglomerative hierarchical clustering using complete linkage. k-Means clustering in Extended Data Fig7e was performed on z-score converted normalized counts and run using the kmeans function in R with nstart = 25 and k=2:10, stopping when clusters became redundant (k=4).

ATAC-seq libraries were prepared at the Epigenetic Innovation Lab at MSKCC starting from ~50,000 live adherent cells plated on 96-wells. Size-selected libraries were submitted to the MSKCC Genomic core for paired-end sequencing at 4060 million reads. Quality control of sequenced reads was performed by FastQC (version 0.11.3) and adapter filtration was performed by Trimmomatic version 0.36. The filtered reads were aligned to the hg19 reference genome. Macs2 (version 2.1.0)77 was used for removing duplicate reads and calling peaks. Differentially accessible peaks in the atlas were called by DESeq2 version 1.1673. To define dynamic trends of chromatin accessibility during neuronal maturation as shown in Fig. 3g, agglomerative hierarchical clustering using Wards linkage method was done on the union of differentially accessible peaks in pairwise comparisons between d25, d50, d75 and d100 samples. HOMER findMotifsGenome.pl (version 4.6)78 was used to investigate the motif enrichment in pairwise comparisons and unbiasedly clustered groups of peaks. Motif enrichment was also assessed by KolmogorovSmirnov and hypergeometric tests as previously described79. ATAC-seq peaks in the atlas were associated with transcription factor motifs in the updated CIS-BP database80,81 using FIMO82 of MEME suite version 4.1183. Hypergeometric test was used to compare the proportion of peaks containing a transcription factor motif in each group (foreground ratio) with that in the entire atlas (background ratio). Odds ratio represents the normalized enrichment of peaks associated with transcription factor motifs in the group compared to the background (foreground ratio/background ratio). Odds ratio1.2 and transcription factor expression from parallel RNA-seq studies (reaching1 RPKM) in neurons at any timepoint (d25, d50, d75, d100) was used to filter enriched transcription factor motif.

CUT&RUN was performed from 50,000 cells per condition as previously described84 using the following antibodies at 1:100 dilution: rabbit anti-H3K4me3 (aab8580, abcam); rabbit anti-H3K9me3 (ab8898, abcam); rabbit anti-H3K27me3 (9733, Cell Signaling Technologies); rabbit anti-H3K27ac (309034, Active Motif), normal rabbit IgG (2729, Cell Signaling Technologies). In brief, cells were collected and bound to concanavalin A-coated magnetic beads after an 8min incubation at room temperature on a rotator. Cell membranes were permeabilized with digitonin and the different antibodies were incubated overnight at 4C on a rotator. Beads were washed and incubated with pA-MN. Ca2+-induced digestion occurred on ice for 30min and stopped by chelation. DNA was finally isolated using an extraction method with phenol and chloroform as previously described84. Library preparation and sequencing was performed atthe MSKCC Integrated Genomic Core.

Sequencing reads were trimmed and filtered for quality and adapter content using version 0.4.5 of TrimGalore (https://www.bioinformatics.babraham.ac.uk/projects/trim_galore) and running version 1.15 of cutadapt and version 0.11.5 of FastQC. Reads were aligned to human assembly hg19 with version 2.3.4.1 of bowtie2 (http://bowtie-bio.sourceforge.net/bowtie2/index.shtml) and MarkDuplicates of Picard Tools version 2.16.0 was used for deduplication. Enriched regions were discovered using MACS2 with a p-value setting of 0.001 and a matched IgG or no antibody as the control. The BEDTools suite version 2.29.2 (http://bedtools.readthedocs.io) was used to create normalized read density profiles. A global peak atlas was created by first removing blacklisted regions (https://www.encodeproject.org/annotations/ENCSR636HFF) then merging all peaks within 500bp and counting reads with version 1.6.1 of featureCounts (http://subread.sourceforge.net). Reads were normalized by sequencing depth (to 10 million mapped fragments) and DESeq2 (v1.22.2) was used to calculate differential enrichment for all pairwise contrasts. Clustering was performed on the superset of differential peaks using k-means clustering by increasing k until redundant clusters arose. Gene annotations were created by assigning all intragenic peaks to that gene, and otherwise using linear genomic distance to transcription start site. The annotations in each cluster were used to intersect with the RNA-seq time series by plotting the average expression z-score of all peak-associated genes which are differentially expressed across any stage. Motif signatures and enriched pathways were obtained using Homer v4.11 (http://homer.ucsd.edu). Tracks of CUT&RUN peaks were visualized in Integrative Genomics Viewer version 2.8.9 (IGV, Broad Institute).

Neuronal cultures at day 27 of differentiation were washed three times in PBS, incubated with Accutase supplemented with Neuron Isolation Enzyme for Pierce (Thermo 88285) solution at 1:50 at 37C for 4560min and gently dissociated to single-cell suspensions via pipetting. After washing in PBS, single-cell suspensions were diluted to 1,000 cells per l in 1 PBS with 0.04% BSA and 0.2Ul1 Ribolock RNAse inhibitor (Thermo EO0382) for sequencing. scRNA-seq was performed at the MSKCC Integrated Genomic Core for a target recovery of 10,000 cells per sample using 10X Genomics Chromium Single Cell 3 Kit, version 3 according to the manufacturers protocol. Libraries were sequenced on an Illumina NovaSeq. The CellRanger pipeline (Version 6.1.2) was used to demultiplex and align reads to the GRCh38 reference genome to generate a cell-by-gene count matrix. Data analysis was performed with R v4.1 using Seurat v4.2.085. Cells expressing between 200 and 5,000 genes and less than 10% counts in mitochondrial genes were kept for analysis. Gene counts were normalized by total counts per cell and ScaleData was used to regress out cell cycle gene expression variance as determined by the CellCycleScoring function. PCA was performed on scaled data for the top 2,000 highly variable genes and a JackStraw significance test and ElbowPlot were used to determine the number of principal components for use in downstream analysis. A uniform manifold approximation and projection (UMAP) on the top 12 principal components was used for dimensional reduction and data visualization. FindNeighbors on the top 12 principal components and FindClusters with a resolution of 0.3 were used to identify clusters. Published scRNA-seq datasets for hPSC cortical differentiation were from Yao et al.86 (PMID: 28094016) and Volpato et al.87 (PMID: 30245212). To compare our dataset to those generated by Yao et al.86 and Volpato et al.87, Seurats anchor-based integration approach85 was used using FindIntegrationAnchors with 5,000 features. Single-cell hierarchical clustering and plotting for Extended Data Fig. 1h was performed with HGC88 using the Louvain algorithm. Single-cell RNA-seq analysis for mouse cortical development in Fig. 3f,g were from the published dataset from Di Bella et al.41 Data were processed using the same pipeline as in the original publication and developmental trajectories were inferred using v1.1.1.URD algorithm89.

Sample sizes were estimated based on previous publications in the field. Investigators were not blinded to experimental conditions. However, for knockout and small molecule treatment studies, samples were de-identified respect to the molecular target. Transcriptional and genomic studies were performed with the same bioinformatic pipeline between conditions.Statistics and data representation were performed in PRISM (GraphPad) version 8,9 or 10, excel and R software version 3.5.2 or 4.1. Statistical tests used for each analysis are indicated in the figures legend. Data are represented as arithmetical means.e.m. unless otherwise indicated.

Independent replication from representative micrographs were as following. Fig. 1b, 6 experiments; Fig. 1j, 3 experiments; Fig. 1n, 2 experiments, Fig. 2d, 2 experiments; Fig. 3c, 2 experiments for each genetic perturbation; Fig. 4m, 4 experiments; Supplementary Fig. 2a, 4 experiments; Supplementary Fig. 2f, 3 experiments; Supplementary Fig. 6e, 1 experiment; Extended Data Figs. 6a, 2 experiments; Extended Data Figs. 6c, 2 experiments; Supplementary Fig. 8e, 2 experiments for d12 and d16.

Further information on research design is available in theNature Portfolio Reporting Summary linked to this article.

Continue reading here:
An epigenetic barrier sets the timing of human neuronal maturation - Nature.com

Engineered cartilage and osteoarthritis – Boston Children’s Answers – Boston Children’s Discoveries

About one in seven adults live with degenerative joint disease, also known as osteoarthritis (OA). In recent years, as anterior cruciate ligament (ACL) injury and other joint injuries have become more common among adolescent athletes, a growing number of 20- and 30-somethings have joined the ranks of aging baby boomers living with chronic OA pain.

Key takeaways

Treatments for degenerative joint disease are limited, largely because the cartilage that protects the joints doesnt regenerate after birth. Without a way to stimulate regrowth of damaged cartilage, most treatments focus on managing symptoms. And with few curative treatment options, OA remains one of the leading causes of pain and disability in the United States.

Boston Childrens researcher April Craft, PhD, and her team want to change that. Their approach: grow cartilage in the lab that could be used to replace damaged articular tissues in patients joints.

The team first set out to understand how cartilage and joint tissues develop naturally and how stem cells differentiate into cartilage cells, or chondrocytes. The next step was to replicate that process in the lab, putting cells through the same stages of development.

In a study published this year in BMJ, members of the Craft Lab described their approach for generating cartilage from induced pluripotent stem cells (iPSC). Derived from patients own cells, iPSCs can give rise to virtually any type of cell in the body, including chondrocytes. The team generated cartilage-like tissues from two patients with progressive pseudorheumatoid arthropathy of childhood (PPAC), a genetic condition that causes severe premature joint degeneration.

We chose to study PPAC because joint degeneration in this condition progresses rapidly toward a state that is indistinguishable from end-stage OA, says Craft. Our iPSC model of PPAC cartilage will help us learn about this devastating disease. Their findings may possibly apply more broadly to OA from acute injuries or chronic overuse, as well as provide the basis for future therapeutics development.

Using cartilage engineered in the Craft Lab, the team has successfully repaired damaged joint tissues in rats and is preparing to test the procedure in large animals.

Because joint-lining cartilage is avascular and the implanted chondrocytes will be encased by the cartilage tissue itself, there is a reduced likelihood of implant rejection. Because of this, Craft believes that someday off-the-shelf cartilage for human patients could be created using one cell line. If so, live cartilage tissues could be produced, stored, and delivered to surgical teams as needed to replace damaged cartilage.

In some ways, the procedure resembles the most advanced cell therapy for cartilage: autologous chondrocyte implantation. In this two-procedure process, chondrocytes are harvested from one area of the body, expanded in number, and then implanted into the damaged area.

Off-the-shelf cartilage implants would allow patients to undergo just one surgical procedure rather than two. Replacing damaged cartilage with a piece of new cartilage that was generated ahead of time would omit the delay in manufacturing associated with autologous cartilage harvesting, reduce the rehabilitation time, and allow patients to return to their normal activities sooner after surgery.

The first humans to receive this novel implant would likely be patients who have pain and joint damage but havent yet progressed to severe degeneration. And eventually, it could be tried in others, such as athletes with joint damage.

This could have a profound impact on people as they age as well as athletes experiencing joint pain, says Craft.

Learn more about the Craft Lab and the Orthopedic Department.

See the rest here:
Engineered cartilage and osteoarthritis - Boston Children's Answers - Boston Children's Discoveries

BlueRock takes up option on iPSC cell therapy candidate OpCT-001 – The Pharma Letter

German pharma major Bayers (BAYN: DE) independently operated company BlueRock Therapeutics today revealed it has exercised its option to exclusively license OpCT-001 under a 2021 deal with FUJIFILM Cellular Dynamics and Opsis Therapeutics.

OpCT-001 is an induced pluripotent stem cell (iPSC) derived cell therapy candidate for the treatment of primary photoreceptor diseases and is the lead cell therapy candidate being developed under the strategic

This article is accessible to registered users, to continue reading please register for free. A free trial will give you access to exclusive features, interviews, round-ups and commentary from the sharpest minds in the pharmaceutical and biotechnology space for a week. If you are already a registered user pleaselogin. If your trial has come to an end, you cansubscribe here.

Try before you buy

All the news that moves the needle in pharma and biotech. Exclusive features, podcasts, interviews, data analyses and commentary from our global network of life sciences reporters. Receive The Pharma Letter daily news bulletin, free forever.

Become a subscriber

Unfettered access to industry-leading news, commentary and analysis in pharma and biotech. Updates from clinical trials, conferences, M&A, licensing, financing, regulation, patents & legal, executive appointments, commercial strategy and financial results. Daily roundup of key events in pharma and biotech. Monthly in-depth briefings on Boardroom appointments and M&A news. Choose from a cost-effective annual package or a flexible monthly subscription.

View original post here:
BlueRock takes up option on iPSC cell therapy candidate OpCT-001 - The Pharma Letter