iPSC culture and differentiation to pan-neurons

SCA1-iPSCs and normal iPSCs were differentiated to pan-neurons87. SCA1-iPSCs and normal iPSCs were cultured in TeSR-E8 medium (STEMCELL Technologies, BC, Canada) with 10M Y27632 (253-00513, Wako, Osaka, Japan). After 24h, medium was changed to Stem Fit (AK02N, Ajinomoto, Tokyo, Japan) containing 5M SB431542 (13031, Cayman Chemical, Ann Arbor, MI, USA), 5M CHIR99021(13122, Cayman Chemical, Ann Arbor, MI, USA), and 5M dorsomorphin (044-33751, Wako, Osaka, Japan). After 5 days, iPSCs were dissociated with TrypLE Select (12563-011, Thermo Fisher Scientific, MA, USA). Neurospheres were then cultured in KBM medium (16050100, KHOJIN BIO, Saitama, Japan) with 20ng/mL Human-FGF-basic (100-18B, Peprotech, London, UK), 10ng/mL Recombinant Human LIF (NU0013-1, Nacalai, Kyoto, Japan), 10M Y27632 (253-00513, Wako, Osaka, Japan), 3M CHIR99021 (13122, Cayman Chemical, Ann Arbor, MI, USA), and 2M SB431542 (13031, Cayman Chemical, Ann Arbor, MI, USA) for 10 days. Finally, neurospheres were dissociated and seeded onto chambers coated with poly-L-ornithine (P3655, Sigma-Aldrich, St. Louis, MO, USA) and laminin (23016015, Thermo Fisher Scientific, Waltham, MA, USA), and cultured in DMEM/F12 (D6421, Sigma-Aldrich, St. Louis, MO, USA) supplemented with B27 (17504044, Thermo Fisher Scientific, Waltham, MA, USA), Glutamax (35050061, Thermo Fisher Scientific, Waltham, MA, USA), and penicillin/streptomycin (15140-122, Thermo Fisher Scientific, Waltham, MA, USA) for 14 days.

SCA1-iPSCs and normal iPSCs were differentiated to Purkinje cells88. To form EBs, iPSCs were dissociated with TrypLE Select (12563-011, Thermo Fisher Scientific, MA, USA), and 24,000 cells were aggregated by centrifugation at 200g for 2min in 96-well U-bottomed culture plates (650-180, Greiner, Kremsmnster, Austria) coated with Lipidure (CM5206, Nichiyu, Tokyo, Japan). Cells were cultured with gfCDM/insulin medium, 1:1 Iscoves modified Dulbeccos medium (12440053, Thermo Fisher Scientific, Waltham, MA, USA), and Hams F-12 (11765054, Thermo Fisher Scientific, Waltham, MA, USA) with 7g/mL insulin (I5500, Sigma-Aldrich, St. Louis, MO, USA); 1x chemically defined lipid concentrate (11905031, Thermo Fisher Scientific, Waltham, MA, USA); 15g/ml apo-transferrin (T4382, Sigma-Aldrich, St. Louis, MO, USA); 450M monothioglycerol (195-15791, Thermo Fisher Scientific, Waltham, MA, USA); 5mg/mL BSA (A7608, Sigma-Aldrich, St. Louis, MO, USA), Glutamax (35050061, Thermo Fisher Scientific, Waltham, MA, USA), and penicillin/streptomycin (15140-122, Thermo Fisher Scientific, Waltham, MA, USA); 20M Y-27632 (253-00513, Wako, Osaka, Japan); and 10M SB431542 (13031, Cayman Chemical, Ann Arbor, MI, USA). After 2 days, 50ng/mL recombinant human FGF2 (233-FB-025, R&D systems, MN, USA) was added to culture medium. After 21 days, EBs were transferred to 10cm Petri dishes (1020-100, Iwaki, Shizuoka, Japan) coated with Lipidure (CM5206, Nichiyu, Tokyo, Japan) and cultured for 14 days in Neurobasal/N2 medium, Neurobasal (21103-049, Thermo Fisher Scientific, Waltham, MA, USA) with N2 supplement (17502048, Thermo Fisher Scientific, Waltham, MA, USA), Glutamax (35050061, Thermo Fisher Scientific, Waltham, MA, USA), and penicillin/streptomycin (15140-122, Thermo Fisher Scientific, Waltham, MA, USA).

EBs were dissociated and cocultured with rhombic lip (RL) cells isolated from cerebellums of E14 Slc:ICR mice to induce differentiation into Purkinje cells. Briefly, RLs and EBs were dissociated with TrypLE Select (12563-011, Thermo Fisher Scientific, MA, USA) and cocultured in DMEM/F12 medium (11330032, Sigma-Aldrich, St. Louis, MO, USA) with 10% FBS, N2 supplement (17502048, Thermo Fisher Scientific, Waltham, MA, USA), and penicillin/streptomycin (15140-122, Thermo Fisher Scientific, Waltham, MA, USA). A total of 1.0106 cells at cell ratio = 1:10 (EB: RL) with 80L medium were seeded on chambers coated with poly-L-lysine (P1524-25MG, Sigma-Aldrich, St. Louis, MO, USA) and laminin (23016015, Thermo Fisher Scientific, Waltham, MA, USA). After incubation for 6h, DMEM/F-12 supplemented with N2 (17502048, Thermo Fisher Scientific, Waltham, MA, USA), 100g/mL BSA (A7608, Sigma-Aldrich, St. Louis, MO, USA), 50ng/mL human BDNF (248-BDB-010/CF, R&D systems, MN, USA), 50ng/mL human NT3 (267-N3-005/CF, R&D systems, MN, USA), and penicillin/streptomycin (15140-122, Thermo Fisher Scientific, Waltham, MA, USA) medium was added and cultured for 10 days.

EB-derived differentiating cells and RL-derived cells were cultured in cell culture insert dishes (140640, Thermo Fisher, Waltham, MA, USA) in which the two types of cells could be separated to avoid RL contamination of RNA-seq samples. The cell culture insert dish was coated with poly-L-lysine (P1524-25MG, Sigma-Aldrich, St. Louis, MO, USA) and laminin (23016015, Thermo Fisher Scientific, Waltham, MA, USA), embryonic body-derived cells were then seeded on the lower well, and RL-derived cells were seeded on a polycarbonate insert with a 4m pore. The culture medium was the same as described above.

To quantify the cell growth rate of SCA1-iPSCs and normal iPSCs, 30,000 iPSCs were seeded per well on Day 0. After 2, 4, 6, or 8 days, cells were collected, dissociated by 0.5 x TrypLE Select (12563-011, Thermo Fisher Scientific, MA, USA) and counted by using Burker-Turk hemocytometer. To quantify the size of iPSC-derived EBs, images of EBs were taken by microscope (IX70, Olympus) on day 1, 7, 14 and 21, and the 2D areas of EBs reflecting their 3D sizes were measured by ImageJ software (version 1.50, NIH, MD, USA).

AAV-HMGB1-EGFP or AAV-EGFP were infected into differentiated pan-neurons (MOI 2000). Twelve days after AAV infection, cells were fixed with 1% paraformaldehyde in PBS for 30min. After blocking in PBS containing 10% FBS for 30min, cells were stained with the following primary and secondary antibodies: mouse anti-III-tubulin 1 (1:2000 for 16h at 4C, #T8660 Sigma-Aldrich, St. Louis, MO, USA), rabbit anti-PSD95 (1:1000 for 16h at 4C, 3409, Cell Signaling Technology, Danvers, MA, USA), donkey anti-mouse IgG Alexa 488-conjugated (1:600 for 1h at room temperature, #715-545-150, Jackson ImmunoResearch Laboratories, West Grove, PA, USA), and donkey anti-rabbit IgG Alexa488-conjugated (1:1000 for 1h at room temperature, A-21206, Thermo Fisher Scientific). The dendritic spine was assessed after acquisition of image by confocal microscopy (FV1200 laser scanning microscope, Olympus, Tokyo, Japan). We used x40 objective lens (UPLSAPO40X2 (NA:0.95)). The dendritic spine density was measured by ImageJ software (version 1.50, NIH, MD, USA). After calibration of scale information, dendrite (Tuj-1-immunostained image) were manually traced and calculate the dendrite length in observing image window. Next, the spine (PSD95-immunostained dots) was counted, and the dendritic spine density was defined as the number of spines in 1m length of a dendrite, calculated by dividing a spine number in one dendrite by the length of it.

Differentiated Purkinje cells were fixed with 1% paraformaldehyde in PBS for 30min. Cells were incubated with 10% FBS followed by incubation with primary and secondary antibodies as follows: mouse anti-Calbindin (1:2000 for 16h at 4C, C9848, Sigma-Aldrich, St. Louis, MO, USA) and donkey anti-mouse IgG Alexa 488-conjugated (1:1000 for 1h at room temperature, A-21202, Thermo Fisher Scientific).

Mice brain tissues at different timepoints (P0, P28, P91, and P392) were fixed with 4% paraformaldehyde in 0.1M phosphate buffer for 12h and embedded in paraffin. Sagittal sections were deparaffinized in xylene and rehydrated in ethanol. For antigen retrieval, sections were incubated in Tris-EDTA solution pH 9.0 (100mM Tris-base and 10mM EDTA) at 121C for 15min. Human brain paraffin sections of SCA1 patients or control sections were also processed. Sections were then incubated with 0.5% triton-X 100 in PBS for 20min to perform permeabilization. Next, sections were incubated with 10% FBS in PBS for 30min and were incubated with primary and secondary antibodies as follows: rabbit anti-ISG15 (1:100 for 16h at 4C, HPA004627, Sigma-Aldrich, St. Louis, MO, USA), mouse anti-Calbindin (1:2000 for 16h at 4C, C9848, Sigma-Aldrich, St. Louis, MO, USA), mouse anti-Atxn1 (1:100 for 16h at 4C, MABN37, Millipore, Burlington, MA, USA), mouse anti-Ub (1:100 for 16h at 4C, #3936, Cell Signaling technology, Danvers, MA, USA), donkey anti-mouse IgG Alexa 488-conjugated (1:600 for 1h, #715-545-150, Jackson ImmunoResearch Laboratories, West Grove, PA, USA), and donkey anti-rabbit IgG Cy3-conjugated (1:600 for 1h, #711-165-152, Jackson ImmunoResearch Laboratories, West Grove, PA, USA). Nuclei were stained with DAPI (0.2g/mL in PBS, D523, DOJINDO Laboratories, Kumamoto, Japan). Z-stacked images (0.5m interval x 5 slices) were acquired from cerebellar cortex (Lobule IV/V) using a confocal microscope (FV1200IXGP44, Olympus, Tokyo, Japan) and a super-resolution microscope (LSM980 with Airyscan 2, Zeiss, Oberkochen, Germany). Signal intensities were measured using ImageJ software.

Male mice brain tissues at different time points (P0, P28, P91, and P392) were homogenized using the BioMasher II (#893062, Nippi, Tokyo, Japan) with RIPA buffer (10mM Tris-HCl pH 7.5, 150mM NaCl, 1mM EDTA, 1% Triton-X 100, 0.1% SDS, 0.1% DOC, and 1:250 volume Protease Inhibitor Cocktail (#539134, Calbiochem, San Diego, CA, USA)). Homogenates were centrifuged at 12,000g for 10min, and supernatants were added to equal volumes of sample buffer (0.1M Tris-HCl pH 6.8, 4% SDS, 20% glycerol, 0.05% BPB, and 12% -mercaptoethanol) and boiled at 100C for 10min. Samples were subjected to SDS-PAGE and transferred onto PVDF membrane. After blocking the membranes with 5% skim milk in TBST (20mM Tris-HCl pH 7.5, 150mM NaCl, 0.05% Tween-20) for 1h, membranes were incubated with primary and secondary antibodies as follows: rabbit anti-ISG15 (1:1000 for 3h at room temperature, HPA004627, Sigma-Aldrich, St. Louis, MO, USA), mouse anti-GAPDH (1:3000 for 16h at 4C, MAB374, Merck, Darmstadt, Germany), mouse anti-Atxn1 (1:1000 for 3h at room temperature, MABN37, Millipore, Burlington, MA, USA), mouse anti-Ub (1:1000 for 16h at 4C, #3936, Cell Signaling Technology, Danvers, MA, USA), mouse anti-Myc (1:3000 for 1h at room temperature, M047-3, MBL, Aichi, Japan), rabbit anti-FLAG (1:3000 for 1h at room temperature, F7425, Sigma, St. Louis, MO, USA), sheep anti-mouse IgG HRP conjugated (1:3000 for 1h, NA931, Cytiva, Tokyo, Japan), and rabbit anti-IgG HRP conjugated (1:3000 for 1h, NA934, Cytiva, Tokyo, Japan). Proteins were detected using Amersham ECL select (RPN2235, Cytiva, Tokyo, Japan) on an Image-Quant luminescence image analyzer LAS500 (Cytiva, Tokyo, Japan). Signal intensities were measured using ImageJ software.

SCA1-iPSCs and normal iPSCs were collected and homogenized in 350L RNA RLT buffer (Qiagen)/0.01% 2-mercaptoethanol (Wako, Tokyo, Japan). Total RNA was purified with RNeasy mini kit (Qiagen). To eliminate genomic DNA contamination, on-column DNA digestion was conducted for each sample with DNase I (Qiagen). Prepared RNA samples were subjected to a HiSeq-based RNA-seq by TAKARA (700 million bp reads).

Gene expression profiles of each sample were evaluated by the number of short reads that were mapped onto gene coding sequences in the reference human genome assembly hg38. Differential expression genes were analyzed with DESeq234. Log2FC (Fold Change) between SCA1-derived and normal cells was calculated by DESeq2, and the difference of gene expression was determined at | Log2FC|>0.5.

To generate the pathological network based on PPI, UniProt accession numbers were added to genes identified in RNA-seq-based gene expression analysis. The pathological PPI network was constructed by connecting genes using the integrated database of the Genome Network Project (GNP) (https://cell-innovation.nig.ac.jp/GNP/index_e.html), which includes BIND, BioGrid (http://www.thebiogrid.org/), HPRD, IntAct (http://www.ebi.ac.uk/intact/site/index.jsf), and MINT. A database of GNP-collected information was created on the Supercomputer System available at the Human Genome Center of the University of Tokyo.

To create a static molecular network, statistically significantly changed molecules were connected at two neighboring time points based on interactions in the PPI database (an integrated database collected by GNP, which includes BIND, BioGrid (http://www.thebiogrid.org/), HPRD, IntAct (http://www.ebi.ac.uk/intact/site/index.jsf), and MINT), without considering their cause-result relationships. Each network starting from a changed molecule was expanded step-by-step from one-hop (directly linked) to six extra connections, and the degree of significance at each expansion step was evaluated by calculating the z-score of their ratio of changed nodes.

To gain insights into the dynamics of the pathological molecular network, a PPI-based chronological molecular network was constructed by connecting two proteins between the two neighboring time points using the integrated PPI database.

To estimate the impact of a significantly differentially expressed gene to the future time point, a gene in a certain time point was connected to a set of genes in the next time point based on the PPI database (an integrated database collected by GNP, which includes BIND, BioGrid (http://www.thebiogrid.org/), HPRD, IntAct (http://www.ebi.ac.uk/intact/site/index.jsf), and MINT) and defined as downstream genes. The magnitude of impact of a gene at the first time point (defined as r) was calculated by the ratio of downstream genes that were significantly changed in mRNA expression levels to all genes at the second time point. The selection of genes was performed based on comparison of impact of a specific gene (specific impact) and total impact at the second time point. The statistical significance of the impact was examined using two-tailed Fishers exact test with post-hoc Benjamini-Hochberg procedure (adjusted p-value<0.05, red dots). The statistical significance of mRNA expression change was examined using log2FC between SCA1 and normal cells (|Log2FC|> 0.5, blue dots). A digraph was created from a significantly differentially expressed gene at the original time point (iPSCs) to significant genes at the end point (Purkinje cells) via significant genes at the intermediate time point based on the impact analysis. The digraph predicts the original gene whose change at the initial time point leads to molecular changes at the final time point.

To select cytokine-relevant genes, Gene Ontology (GO) enrichment analysis was performed using clusterProfiler89 package in R. A list of genes included in a selected pathway was used as input of enrichGO function of clusterProfiler. From all the enrichment results, GO terms related to cytokine were selected to extract a list of cytokine-relevant genes. The GO terms related to cytokine were searched by keyword cytokine, and thereafter terms that were not related to cytokine such as cytokinesis were excluded.

A search for transcriptomic studies of SCA1 in Homo sapiens and Mus musculus in the NCBI Sequence Read Archive (SRA; https://www.ncbi.nlm.nih.gov/sra) was performed on August 7, 2023 using the keywords spinocerebellar ataxia type 1 and SCA1. Eight studies (PRJNA305316, PRJNA422988, PRJNA472147, PRJNA472754, PRJNA503578, PRJNA688073, PRJNA871289, and PRJNA903078) that include RNA-seq data and raw sequence information generated from cerebellar tissues of SCA1 mouse models were found, while no studies with human RNA-seq data were found.

Raw sequence data were downloaded from NCBI SRA using the SRA Toolkit (https://github.com/ncbi/sra-tools) and mapped to the M. musculus genome assembly GRCm38/mm10 using HISAT2. Gene expression was calculated using the featureCounts function from Subread v1.5.2. Gene expression differences between the SCA1 and control groups were tested using Welchs t-test. Gene expression changes with a p-value0.05 were considered significant.

RNA was isolated from iPSCs, EBs and Purkinje cells with TRIzol RNA Isolation Reagents (15596026, Thermo Fisher Scientific, MA, USA). Reverse transcription was performed by using the SuperScript VILO cDNA Synthesis kit (11754-250, Invitrogen, Carlsbad, CA, USA). Quantitative PCR analyses were performed with the 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) by using THUNDERBIRD SYBR qPCR Mix (QPS-201, TOYOBO, Osaka, Japan) and assessed by the standard curve method. The primer sequences were:

ISG15, forward primer: 5-CGCAGATCACCCAGAAGATCG-3 and reverse primer: 5- TTCGTCGCATTTGTCCACCA-3

UbE2L6, forward primer: 5-GTGGCGAAAGAGCTGGAGAG-3 and reverse primer: 5 -ACACTGTCTGCTGGTGGAGTTC- 3

ARIH1, forward primer: 5-CAGGAGGAGGATTACCGCTAC-3 and reverse primer: 5-CTCCCGGATACATTCCACCA-3

GAPDH, forward primer: 5-AGATCATCAGCAATGCCTCCTG-3 and reverse primer: 5-ATGGCATGGACTGTGGTCATG-3

PCR conditions for amplification were 40 cycles of 95C for 1min for enzyme activation, 95C for 15sec for denaturation, and 60C for 1min for extension. The expression levels of ISG15, UbE2L6 and ARIH1 were corrected by GAPDH.

Frozen mouse brains (male, P28) were lysed with TNE buffer (10mM Tris-HCL (pH 7.5), 150mM NaCl, 1mM EDTA, and 1% NP-40) and collected by centrifugation (15,000g10min). Aliquots (100g protein in cerebellar tissue lysate) were then incubated 1h with a 50% slurry of protein G-sepharose beads. After centrifugation (2000g3min), the supernatants were incubated with 1g rabbit anti-ISG15 antibody (aHPA004627, Sigma-Aldrich, St. Louis, MO, USA) overnight at 4C. Reactants were then incubated with Protein G-sepharose beads for 4h, washed with TNE buffer, and eluted by sample buffer. For double-precipitation, samples were incubated with 2g biotin-labeled mouse anti-Ub (#3936, Cell Signaling technology, Danvers, MA, USA) overnight at 4C, followed by incubation with streptavidin beads (TrueBlot(R) Streptavidin Magnetic Beads, S000-18-5, Rockland, Pottstown, PA, USA). The collected samples were further incubated with 2g mouse anti-Atxn1 (MABN37, Millipore, Burlington, MA, USA) overnight at 4C. Then, reactants were incubated with Protein G-sepharose beads for 4h, washed with TNE buffer, and eluted in sample buffer.

HeLa cells were seeded at a density of 4105 cells/well in a 6-well plate (3516, Corning, Glendale, AZ, USA) and transfected with 30 pmol human ISG15-siRNA (sc-43869, Santa Cruz Biotechnology, Dallas, TX, USA) or scrambled siRNA (SR30004, OriGene, Rockville, MD, USA) using 4L Lipofectamine RNAiMAX (13778-075, Thermo Fisher Scientific, Waltham, MA, USA). At 24h after siRNA transfection, 2.5g myc-Ataxin1-33Q, myc-Ataxin1-86Q, or FLAG-Ku70 plasmid was transfected using 5L Lipofectamine 2000 (11668-019, Thermo Fisher Scientific, Waltham, MA, USA). At 48h after siRNA transfection, 100nM Bafilomycin A1 (BVT-0252-C100, AdipoGen, Liestal, Basel-Landschaft, Switzerland) or 5M MG132 (139-18451 Wako, Osaka, Japan) was added to the culture medium in order to inhibit autophagy or proteasome-dependent protein degradation, respectively. At 49h, 100g/mL cycloheximide (033-20993, Wako, Osaka, Japan) was added to the culture medium in order to inhibit protein synthesis. The cells were collected at 0, 6, 12, and 24h after addition of cycloheximide, lysed with RIPA buffer (10mM Tris-HCl pH 7.5, 150mM NaCl, 1mM EDTA, 1% Triton-X 100, 0.1% SDS, 0.1% DOC, and 1:250 volume Protease Inhibitor Cocktail (#539134, Calbiochem, San Diego, CA, USA)), and centrifuged at 12,000g for 10min. The supernatants were mixed with equal volumes of sample buffer (0.1M Tris-HCl pH6.8, 4% SDS, 20% glycerol, 0.05% BPB, and 12% -mercaptoethanol), boiled at 100C for 10min, and subjected to SDS-PAGE.

Mutant Atxn1-KI mice (Sca1154Q/2Q mice) were generously gifted by Prof. Huda Y. Zoghbi (Baylor College of Medicine, TX, USA)39. The backcrossed strain with C57BL/6 mice were further crossed with C57BL/6 female mice more than 10 times in our laboratory. The number of CAG repeats was checked by fragment analysis using the following primers: forward (5CACCAGTGCAGTAGCCTCAG3, labeled with 6-carboxyfluorescein) and reverse (5AGCTCTGTGGAGAGCTGGAA3). Mice were maintained under suitable humidity (around 50%) at 22C with a 12h light-dark cycle. We have complied with all relevant ethical regulations for animal use.

Cerebellar specimens collected at autopsy from three SCA1 patients and three control patients without neurological disorders (lung cancer, leukemia, and cholangiocarcinoma) were used. The details of the SCA1 patients (51-year-old female, 54-year-old female, and 50-year-old male) were described previously90,91,92. Their CAG repeat expansion in the Atxn1 gene was confirmed by PCR and their numbers of CAG repeats were around 50, although the exact numbers were not determined by fragment analysis or Sanger sequencing. Human plasma samples were acquired from SCA1 patients with a PCR-based genetic diagnosis or control patients without neurological disorders. Essential information about the SCA1 patients and controls is shown in Fig.8D. Other clinical information is not linked with samples according to ethics regulations. All ethical regulations to human research participants were followed.

In total, 100 L of human plasma samples that had been diluted 2-fold with saline (OTSUKA normal saline 20mL, Otsuka Pharmaceutical Factory, Tokushima, Japan) was added to a 96-well plate precoated with an anti-ISG15 antibody (#CY-8085, CircuLex Human ISG15 ELISA Kit, MBL, Tokyo, Japan) and incubated for 16h at 4C. Plates were washed and subsequently incubated with a peroxidase-conjugated anti-ISG15 antibody (Atlas Antibodies, HPA004627-100UL, Bromma, Sweden) for 2h at room temperature. For detection, Substrate Reagent (#CY-8085, CircuLex Human ISG15 ELISA Kit, MBL, Tokyo, Japan) was added to each well. The reaction was terminated with Stop Solution (#CY-8085, CircuLex Human ISG15 ELISA Kit, MBL, Tokyo, Japan), and absorbance at 450nm was measured on a microplate reader (SPARK 10M, TECAN, Grodig, Austria). A standard curve was generated using 0, 1.5, 3, 6, and 12ng/mL Recombinant Human ISG15 (UL-601-500, R&D Systems, Minneapolis, MN, USA) diluted with Sample Diluent (326078738, HMGB1 ELISA Kit Exp, Shino-test, Tokyo, Japan).

We analyzed three iPSC lines derived from two SCA1 patients for RNA-seq-based gene expression analysis. For meta-analysis using SCA1 model mice, we collected RNA-seq data from 3 to 17 mice in each time point from NCBI SRA database. Statistical analyses for biological experiments were performed using Graphpad Prism 8. Biological data following a normal distribution are presented as the meanSEM, with Tukeys HSD test or Dunnetts test for multiple group comparisons or with Welchs t-test for two group comparisons. The distribution of observed data was depicted with box plots, with the data also plotted as dots. Box plots show the medians, quartiles, and whiskers, which represent data outside the 25th75th percentile range. To obtain each data, we performed biologically independent experiments. The number of samples was indicated in each figure and figure legends.

This study was performed in strict accordance with the recommendations of the Guide for the Care and Use of Laboratory Animals of the Japanese Government and National Institutes of Health. All experiments were approved by the Committees on Gene Recombination Experiments, Human Ethics, and Animal Experiments of the Tokyo Medical and Dental University (G2018-082C3, 2014-5-3, and A2021-211A). Human samples including post-mortem brains were provided with informed consent and their use was approved by the Committees on Human Ethics (O2020-002-03).

Further information on research design is available in theNature Portfolio Reporting Summary linked to this article.

Read more here:
Dynamic molecular network analysis of iPSC-Purkinje cells differentiation delineates roles of ISG15 in SCA1 at the ... - Nature.com