Stem Cell Clinic

Scientists Created a Monkey With Two Different Sets of DNA – Smithsonian Magazine

The monkey "chimera" with two sets of DNA at three days old. Some body parts appear tinted green, because the researchers marked the transplanted cells with fluorescent dye to trace what parts they developed into. Cell / Cao et al.

Researchers have created a monkey with two different sets of DNAby injecting stem cells from one monkey embryo into another of the same species. This method has been used in rats and mice beforebut the recent feat marks the first time ever that it has been successful in another animal, including primates. Scientists say the breakthrough could help with medical research in the future.

This is a long-sought goal in the field, Zhen Liu of the Chinese Academy of Sciences (CAS) says in a statement. This work could help us to generate more precise monkey models for studying neurological diseases as well as for other biomedicine studies.

However, the monkey had to be euthanized after ten days due to breathing issues and hypothermia, which some scientists say highlights ethical concerns in this type of research, reports Nature News Carissa Wong.

In reference to the mythological, fire-breathing chimera that has a lions head, a goats body and a serpents tail, individuals that contain two or more different sets of DNA in their bodies are referred to as chimeric by scientists. Chimerism can occur naturally, as when one embryo in a set of fraternal twins dies in the womb and the other absorbs its cells. This has been documented in several species of birds, reptiles and mammals, including humans.

But chimerism can also occur artificially with an organ or bone marrow transplant. In this case, the researchers transplanted stem cells, which can develop into any kind of cell.

To create the monkey chimera, Liu and his colleagues removed stem cells from seven-day-old embryos of long-tailed macaques (Macaca fascicularis). They labeled these with green fluorescent protein so that any tissue the cells created in a chimeric monkey could be visually identified later. They then injected these cells into four- to five-day-old embryos of the same species and implanted them into 40 female macaques.

Of these surrogate mother monkeys, 12 became pregnant, and 6 gave birth to live young. The teams analysis showed that just one live-birth male and one miscarried male were substantially chimeric. In the live monkey, donor cells made up 67 percent of its tissues on average, but across the 26 different tissue types tested, that number ranged between 21 percent and 92 percent.

Scientists saw evidence of glowing green fluorescencethe mark of the donor cellsin the live monkeys fingertips and around its eyes. Percentages of donor cells in the miscarried fetus were lower. The team published its research this month in the journal Cell.

It is a very good and important paper, Jacob Hanna, a stem cell biologist and embryologist at the Weizmann Institute of Science in Israel who was not involved with the study, tells CNNs Katie Hunt. This study may contribute to easier and better making of mutant monkeys, just like biologists have been doing for years with mice. Of course, work with [nonhuman primates] is slower and much harder but is important.

Researchers have been creating chimeric mice since the 1960s to learn more about critical developmental processes, including how stem cells grow into more specialized cells. Theyve also used the mice as models to study diseases. But trying to understand humans by looking at rodents has its limitations.

Mice dont reproduce many aspects of human disease for their physiology being too different from ours, Liu tells CNN. In contrast, human and monkey are close evolutionary, so human diseases can be more faithfully modeled in monkeys.

In controversial research, scientists have previously created human-monkey chimeric embryos, though these only grew for 20 days before being destroyednot long enough to develop a brain or nervous system. Some scientists hope these techniques could be used to grow human organs inside other animals for transplantation, per Nature News. But such efforts involving animalsespecially once human cells are addedcan quickly pose ethical quandaries.

All animal research warrants careful consideration, but this is particularly important for all non-human primate research, stem cell researcher Megan Munsie, of the University of Melbourne and Murdoch Childrens Research Institute, tells Peter de Kruijff of the Australian Broadcasting Corporation (ABC).

Munsie notes to the publication that, of all 74 chimeric monkey embryos transferred into surrogate mothers in the recent study, only one living macaque produced the desired resultsand it had to be euthanized. Future efforts should focus on improving embryo viability to avoid the high abortion rate and associated distress and waste, she adds.

Additionally, long-tailed macaques, while commonly used as lab monkeys, were listed as endangered by the International Union for Conservation of Nature last year. Munsie suggests limiting research to animals that are not endangered, per the ABC. The authors, however, say this research could help with conservation efforts.

Monkey chimeras also have potential enormous value for species conservation if they could be achieved between two types of nonhuman primate species, one of which is endangered, co-author Miguel Esteban, of the Guangzhou Institute of Biomedicine and Health, Chinese Academy of Sciences, and a researcher with BGI-Research Hangzhou, tells CNN. If there is contribution of the donor cells from the endangered species to the germ line, one could envisage that, through breeding, animals of these species could be produced.

Get the latest stories in your inbox every weekday.

Recommended Videos

Read this article:
Scientists Created a Monkey With Two Different Sets of DNA - Smithsonian Magazine

Stem Cell Banking Market Size Revenue Hits $18.04 Billion by 2032 … – GlobeNewswire

Newark, Nov. 20, 2023 (GLOBE NEWSWIRE) -- The Brainy Insights estimates that the USD 7.93 Billion in 2022stem cell banking market will reach USD 18.04 Billion by 2032. As stem cell transplants become more viable therapeutic options, the demand for a reliable and secure source of stem cells has increased significantly. Stem cell banks are critical to the success of these treatments because they provide a secure and dependable means of storing and transferring stem cells for transplantation.

Request to Download Sample Research Report - https://www.thebrainyinsights.com/enquiry/sample-request/13795

Report Coverage Details

Key Insight of the Stem Cell Banking Market

Asia Pacific is anticipated to expand at the highest CAGR of 10.55% over the projection period.

Asia Pacific is expected to grow at the highest CAGR of 10.55% over the forecast period. It is due to increased public knowledge of stem cell's medical potential, as well as increased government spending in stem cell research and development. For many years, India has been at the forefront of medical advancements as one of the most popular foreign destinations for medical tourism. Furthermore, the development of novel treatments and procedures, as well as the higher success rate of stem cell treatment, are likely to drive expansion in the region's stem cell banking business.

The adult stem cells segment is expected to register the highest CAGR of 10.32% over the projected period in the stem cell banking market.

The adult stem cells segment is anticipated to grow at the highest CAGR of 10.32% in the stem cell banking market. The growing understanding of the variety and effectiveness of adult stem cell banking services is driving up demand. Adult stem cell preservation is being considered by patients, physicians, and researchers as a proactive strategy to future disease problems. This need promotes business competitiveness and innovation, resulting in enhanced storage systems and broader service offers.

Over the projected period, the sample preservation and storage segment is expected to register the highest CAGR of 10.73% in the stem cell banking market.

Over the forecasted period, the sample preservation and storage segment is anticipated to grow at the highest CAGR of 10.73% in the stem cell banking market. This vital service area includes cutting-edge cryopreservation processes, cutting-edge storage facilities, and stringent quality control systems. In this age of regenerative medicine, the efficiency of stem cell treatments is dependent on the quality and accessibility of preserved samples.

Procure Complete Research Report - https://www.thebrainyinsights.com/report/stem-cell-banking-market-13795

Market Dynamics

Driver: A growing elderly population

An older population has a favourable impact on the market. This demographic shift is changing healthcare dynamics all around the world. As people age, they become more susceptible to degenerative diseases such as osteoarthritis, cardiovascular disease, and neurological disorders such as Alzheimer's and Parkinson's. Stem cells have immense promise for repairing damaged or ageing tissues, paving the way for new treatments and better quality of life for the elderly. This ageing population necessitates more modern healthcare treatments and represents a significant client base for stem cell banking services. Many people and families are aware of the option of keeping stem cells from themselves or loved ones, which can be taken from sources such as cord blood or adipose tissue. These stem cells can be used in future therapies to combat age-related health issues, offering comfort and hope.

Opportunity: Growing ethical issues over the use of embryonic stem cells

The market is being fueled by growing ethical concerns about the use of embryonic stem cells. Because embryonic stem cell research involves the killing of embryos, it has long been a subject of ethical debate, leading in moral and legislative constraints in a variety of domains. This has shifted the emphasis of stem cell research and therapeutic applications away from controversial sources and towards non-controversial sources such as adult stem cells and cord blood. As a result, it is becoming popular among individuals and institutions seeking the potential benefits of stem cell therapy without the ethical ambiguity of stem cell banking. Cord blood, in particular, has grown in prominence as a rich source of stem cells that is ethically sound. Families and healthcare practitioners recognise the value of keeping these cells as a form of biological insurance against future illnesses for the donor and potentially compatible family members.

Interested to Procure the Research Report? Inquire Before Buying -https://www.thebrainyinsights.com/enquiry/buying-inquiry/13795

Some of the major players operating in the stem cell banking market are:

Cordlife Cryo-Save AG (A Group of Esperite) Stemcyte Smart Cells International Ltd. Cordvida CBR Systems, Inc. Lifecell Cryoviva India Cryo-Cell Viacord

Key Segments cover in the market:

By Product Type:

Human Embryonic Cells Adult Stem Cells IPS Cells

By Service Type:

Sample Analysis Sample Collection and Transportation Sample Preservation and Storage Sample Processing

By Region

North America (U.S., Canada, Mexico) Europe (Germany, France, U.K., Italy, Spain, Rest of Europe) Asia-Pacific (China, Japan, India, Rest of APAC) South America (Brazil and the Rest of South America) The Middle East and Africa (UAE, South Africa, Rest of MEA)

About the report:

The market is analyzed based on value (USD Billion). All the segments have been analyzed worldwide, regional, and country basis. The study includes the analysis of more than 30 countries for each part. The report analyzes driving factors, opportunities, restraints, and challenges for gaining critical insight into the market. The study includes porter's five forces model, attractiveness analysis, product analysis, supply, and demand analysis, competitor position grid analysis, distribution, and marketing channels analysis.

About The Brainy Insights:

The Brainy Insights is a market research company, aimed at providing actionable insights through data analytics to companies to improve their business acumen. We have a robust forecasting and estimation model to meet the clients' objectives of high-quality output within a short span of time. We provide both customized (clients' specific) and syndicate reports. Our repository of syndicate reports is diverse across all the categories and sub-categories across domains. Our customized solutions are tailored to meet the clients' requirements whether they are looking to expand or planning to launch a new product in the global market.

Contact Us

Avinash D Head of Business Development Phone: +1-315-215-1633 Email: sales@thebrainyinsights.com Web: http://www.thebrainyinsights

Originally posted here:
Stem Cell Banking Market Size Revenue Hits $18.04 Billion by 2032 ... - GlobeNewswire

Metastases and treatment-resistant lineages in patient-derived … – Nature.com

Selection of patients and 2DOs

Eight patients with distant metastases or recurrences that could be evaluated using computed tomography were selected. All patients underwent baseline imaging within 4 weeks before anticancer drug administration. The tumor volume and reduction rate were measured according to RECIST guidelines42. 2DOs were established from primary CRC specimens and cultured according to a previous report20 and stocked at our laboratory cell bank. Briefly, CRC tissue from resected specimens was minced into 1-mm pieces and dissociated with 1mg/mL of collagenase (C6885; Sigma-Aldrich, St. Louis, MO, USA). Filtered cell pellets between 20m and 200m were seeded in plates coated with iMatrix-511 (Takara Bio Inc., Kusatsu, Japan) and cultured in medium containing 10ng/mL of basic fibroblast growth factor (ThermoFisher Scientific, Waltham, MA, USA) and 2ng/mL of transforming growth factor beta (R&D Systems Inc., Minneapolis, MN, USA) to maintain heterogeneous primary culture cells. Sixteen 2DOs with stable culture and drug sensitivity on testing, including eight 2DOs from patients with distant metastases or recurrences, were selected for further analysis.

The human colorectal tumor cell lines, HCT116, gifted by Dr. Bert Vongelstein (Johns Hopkins University, Baltimore, MD, USA), and HT29 (EC91072201, ECACC), were cultured in Dulbeccos modified Eagles medium supplemented with 10% fetal bovine serum (ThermoFisher Scientific), 1% GlutaMAXI (ThermoFisher Scientific), and 1% penicillin/streptomycin/amphotericin B (Wako Pure Chemical Industries, Osaka, Japan). Cells were incubated at 37C in a humidified atmosphere containing 5% CO2. Cells were harvested using 0.25% Trypsin-EDTA (ThermoFisher Scientific) for further analysis.

Cellartis human iPS cell line 12 (ChiPSC12) cells (Takara Bio) were cultured in the Cellartis DEF-CS 500 Culture System (Takara Bio). Cells were incubated at 37C in a humidified atmosphere containing 5% CO2. Cells were harvested using Accutase (Innovative Cell Technologies, Inc., San Diego, CA) for further analysis.

The expression of proteins in cells was determined using flow cytometry. Cultured cells were dissociated with Accutase (Nacalai Tesque Inc., Kyoto, Japan). CTCs were isolated from clinical blood samples using OncoQuick (Greiner BioOne, Frickenhausen, Germany) according to the manufacturers protocol. Cells were stained with antibodies targeting EpCAM, CD133, CD44, CD41, CD45, and LGR5 (Supplementary TableS2). For detecting POU5F1, a True-Nuclear Transcription Factor Buffer Set (424401; BioLegend) was used. After staining cell surface proteins, cells were fixed and stained with antibodies for POU5F1, according to the manufacturers protocol. Relative fluorescent intensities were measured with an SH800 cell sorter (SONY, Tokyo, Japan) and cell morphology and staining locations were also measured with a FlowSight imaging flow cytometer (Merck-Millipore, Darmstadt, Germany). 7-AAD (Miltenyi Biotec, San Diego, CA, USA) was used to analyze living cells. A dimensionality reduction step in two dimensions was performed using t-distributed stochastic neighbor embedding (t-SNE) to visualize high-dimensional data of stem cell marker expression. Data were analyzed using FlowJo 10.2 software (FlowJo LLC, Ashland, OR, USA).

Anticancer drug sensitivity was examined in sixteen 2DOs within 510 passages. Drugs and their concentrations in clinical drug assays are listed in Supplementary TableS3. The number of viable cells in each well was measured using a Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan) before drug administration and 96h after drug administration. Cell proliferation in DMSO and distilled water, which were used to dilute each drug, were used as controls. The ratio of the number of living cells after administering the drug to the control is shown. Three independent experiments were performed and the average is shown. The formula used for calculation was as follows: 100Cont. 0h cell num.Drug 96h cell num./{(Cont. 96h cell num.Cont. 0h cell num.) Drug 0h cell num.}

Regarding the sensitivity of each anticancer drug, a dimensionality reduction step in two dimensions was performed using t-SNE to visualize high-dimensional data for 21 drugs in a low-dimensional space. The statistical analyses were performed using R 3.6.3 (R Core Team, 2018), with the data.table (v1.12.8; Dowle & Srinivasan43), t-SNE (Krijthe44), and ggplot2 (Wickham45) packages.

Total RNA was extracted using an RNA Purification Kit (Qiagen, Hilden, Germany). TruSeq Stranded mRNA Library Prep (Illumina, San Diego, CA, USA) was used to prepare RNA-seq libraries from the total RNA (1g). Multiplexed libraries were sequenced on an Illumina NextSeq with single-end 75-bp sequencing. RNA-seq data were mapped to the hg38 genome release using the bioinformatic pipeline of the Illumina Base Space Sequence Hub and the Subio software platform (Subio, Inc., Kagoshima, Japan).

The vector, PL-SIN-Oct4-EGFP, kindly provided by James Ellis (Addgene plasmid #21319; http://n2t.net/addgene:21319)22, was used to establish cells expressing EGFP under the OCT4 (POU5F1) promoter. The vector was transfected into 2DOs and cell lines using Lentiviral High Titer Packaging Mix with pLVSIN (Takara Bio). EGFP-positive cells were purified by sorting using a SH800 cell sorter (SONY) at least twice. POU5F1 expression was confirmed by polymerase chain reaction (PCR).

Total RNA was isolated using an RNA Purification Kit (Qiagen). Quantitative assessment was performed by real-time PCR using 100nM universal probe libraries, 0.1 FASTStart TaqMan Probe Master (Roche Diagnostics, Basel, Switzerland) for designed primers, iTaq Universal SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) for commercially available primers, 100nM primers, and 10ng cDNA for cDNA amplification of target genes. Primers are listed in Supplementary TableS4. PCR was performed with 20L of the master mix in each well of a 96-well plate, and signals were detected with the CFX Connect Real-Time PCR Detection System (Bio-Rad). The thermocycler was programmed for one cycle at 95C for 10min, followed by 40 cycles at 94C for 10s, 60 C for 20s, and 72 C for 1s. cDNAs from NTERA-2 cells were used as positive controls.

A subcutaneous model was established to investigate the ability to differentiate from a single sorted cell. A single sorted cell was cultured in a dish for expansion using the 2DO culture methods described above. Accutane-dissociated cells (1106 cells) suspended in Matrigel (BD Biosciences, Franklin Lakes, NJ, USA) were subcutaneously transplanted into the dorsal flanks of 7-week-old, non-obese diabetic/severe combined immunodeficient mice (CLEA, Tokyo, Japan). The average weight was 27g at the start of the experiments. The mice were sacrificed when the tumors reached a diameter of 10mm. For the liver metastasis model, live cells (1106 cells) were sorted by 7-AAD (Miltenyi Biotec) according to EGFP expression using a SH800 cell sorter (SONY) and injected into the spleen. Liver metastasis was assessed every 4 weeks. Mice were sacrificed 8 weeks after injection for the assessment of liver metastases in the POU5F1 expression metastatic ability experiment and 10 weeks after injection in the XAV939 experiment.

Xenograft tumors were fixed in formalin, processed through a series of graded concentrations of ethanol, embedded in paraffin, and sectioned. Sections were stained with hematoxylin and eosin (H&E). Three-dimensional (3D)-formed 2DOs cultured on a NanoCulture plate were collected and centrifuged at 400g for 5min at room temperature. The pellet was consolidated using iPGell (GenoStaff Co., Ltd., Tokyo, Japan) and fixed in formalin. The pellet was processed through a series of graded concentrations of ethanol, embedded in paraffin, sectioned, and stained with H&E.

Xenograft tumors were also fixed in 10% buffered formalin and embedded in paraffin blocks. For cultured 2DOs, 3D-formed 2DOs cultured on an Ultra-Low Attachment Multiple Well Plate (Corning, NY, USA) were collected and centrifuged at 400g for 5min at room temperature. They were embedded in paraffin blocks using iPGell (GenoStaff). A 3-m section was obtained from each block. Sections were deparaffinized, and slides were boiled for 15min. Expressions of CD44, CK20, MUC2, and chromogranin A were quantified using antibodies (Supplementary TableS5). The slides were incubated with a primary antibody for 60min at room temperature and then incubated with a secondary antibody for 30min at room temperature. Slides were mounted in Prolong Gold with DAPI (Invitrogen, Waltham, MA, USA). Mucus production ability was assessed via Alcian blue staining (pH 2.5).

Cultured cells were fixed with 4% formaldehyde and blocked. They were incubated with primary antibodies (Supplementary TableS6) overnight at 4C. Cells were incubated with secondary antibodies for 90min. Slides were mounted in Prolong Gold with DAPI (ThermoFisher Scientific) overnight.

The vector, pLV[Exp]-Neo-CMV>DsRed_Express2, was constructed by VectorBuilder, Inc. (Chicago, IL, USA) (Supplementary Fig.S27). This vector was transfected into 2DOs and iPS cells using Lentiviral High Titer Packaging Mix with pLVSIN (Takara Bio). DsRed_Express2-positive cells were selected by antibiotic selection using G418 (10131035; ThermoFisher Scientific) and sorted twice by an SH800 cell sorter (SONY). All cells expressing DsRed-Express2 were detected by an SH800 cell sorter (SONY).

The vector, PL-SIN-Oct4-EGFP, kindly provided by James Ellis (Addgene plasmid #21319)22, and the vector, pMSCV-F-del Casp9.IRES.GFP, kindly provided by David Spencer (Addgene plasmid # 15567)46, were used to establish cells expressing EGFP under the OCT4 (POU5F1) promoter with inducible caspase 9. Sequence-encoding caspase 9 was digested with restriction enzymes, XhoI (R0146S; New England Biolabs, Beverly, MA, USA) and EcoRI-HF (R3101S; New England Biolabs). The DNA fragment of caspase 9 was extracted from E-Gel CloneWel 0.8% (G6500ST; ThermoFisher Scientific) using the E-Gel Power Snap Electrophoresis System (ThermoFisher Scientific) (Supplementary Fig.S28). The fragment was amplified using CloneAmp HiFi PCR Premix (Z9298N; Takara Bio) with designed primers (FW_gaattctgcagtcgatcgagggagtgcaggtgg, RV_ccgcggtaccgtcgacttagtcgagtgcgtagtc). The vector, PL-SIN-Oct4-EGFP, was linearized by a restriction enzyme, SalI-HF (R3138S; New England Biolabs). The amplified fragments and linearized vector were used for the cloning reaction by the In-Fusion HD Cloning Kit (Z9648N; Takara Bio). The transformation procedure was performed using Competent High E. Coli DH5 (TYB-DNA903; Toyobo, Osaka, Japan), and the plasmid was extracted using the Qiagen Plasmid Plus Midi Kit (12945; Qiagen). The nucleotide sequence of the vector was confirmed by Sanger sequencing, performed by GENEWIZ Japan Corp. (Kawaguchi, Japan). Primer extension sequencing was performed using Applied Biosystems BigDye version 3.1, and the reactions were then run on an Applied Biosystem 3730xl DNA Analyzer. The constructed vector was transfected into two 2DOs (603iCC and 25DiCC) using Lentiviral High Titer Packaging Mix with pLVSIN (Takara Bio). EGFP-positive cells were cloned by single-cell sorting using an SH800 cell sorter (SONY). POU5F1 expression was confirmed by PCR, and a decrease in the number of EGFP-positive cells was confirmed by the administration of B/B Homodimerizer (Z5059N; Takara Bio). The mean provirus copy number was 6.05 (1.16, n=6), as measured using the Let-X Provirus Quantitation Kit (Z1239N; Takara Bio).

603iCC-transfected POU5F1-EGFP cells with inducible caspase 9 (4.5104/well) were seeded, and 5M B/B Homodimerizer (Takara Bio) was administered for three days. Four days after the dimerizer was removed, live cells were sorted using an SH800 cell sorter (SONY) as day 7 cells. For cells not treated with a dimerizer, live cells were also sorted as day 0 cells. Single-cell library preparation was performed following the manufacturers instructions for the Chromium Next GEM Single Cell 3 Reagent Kit (v3.1) (10x Genomics, Pleasanton, CA, USA), and the libraries were sequenced on a HiSeq X sequencer (Illumina). To generate a data matrix, the Cell Ranger pipeline (v4.0.0) was applied, and raw reads were aligned to the human reference genome (GRCh 38) using the STAR aligner. For GFP transcript mapping, the GFP sequence (XM_013393261) was added to the reference fastq and gtf files. Data were deposited in Gene Expression Omnibus under the accession number GSE169220.

Seurat (version 3.2.0)47 was used for quality control and downstream analysis. Poor-quality cells were filtered out using the following parameters: nFeature_RNA 2009000 and percent.mt <10. A total of 6942 cells (control: 3342 cells and day 7: 3602 cells), which passed the quality control, were finally used for further analysis. Mitochondrial genes were filtered by mt.percent (<10). UMAP visualization was used for dimensionality reduction analysis with the following parameters: resolution, 0.5; and perplexity, 20. Marker genes discriminating the different clusters were identified using the FindAllMarkers function (min.pct=0.25 and log[fold-change] >0.25). Pathway enrichment analysis was performed using Enrichr48 (https://maayanlab.cloud/Enrichr/). To construct a single-cell pseudotime trajectory, the Monocle3 (v0.2.2) algorithm was applied (https://cole-trapnell-lab.github.io/monocle3/). After converting the Seurat object using the as.cell_data_set function, the root node was assigned to cluster 4, and the orderCells function was used to assign cells a pseudotime value. To subdivide cells based on their branch in the trajectory, the choose_graph_segments function was applied, and cluster 6 was chosen as an ending node.

Western blot analysis was performed to examine proteins associated with the Wnt/-catenin signaling pathway. Cells were lysed in 50mM TrisHCl (pH 7.6), 1% Nonidet P-40, 150mM sodium chloride, and 0.1mM zinc acetate in the presence of protease inhibitors. Protein concentration was determined by the Lowry method (Bio-Rad), and 20g of each sample was separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis. The gel was transferred electrophoretically onto a polyvinylidene difluoride membrane (Millipore, Billerica, MA, USA). The membrane was blocked with blocking buffer for 1h and then incubated overnight at 4 C with primary antibodies against -catenin (1:1000, 8480, Cell Signaling Technology), Wnt-3a (1:5000, GTX128101, Gene Tex, CA, USA), and HistoneH3 (1:2000, 4499S, Cell Signaling Technology). After a 2-h incubation with the secondary antibody, horseradish peroxidase-conjugated rabbit antibody (1:400, 7074S, Santa Cruz Biotechnology Inc., Dallas, TX, USA), protein bands were visualized using an ECL detection kit (ThermoFisher Scientific) according to the manufacturers instructions.

DNA samples were treated with sodium bisulfite using a bisulfite conversion kit (Zymo Research EZ DNA methylation Kit). After treatment, unmethylated cytosines convert to uracil, while methylated cytosines remain unchanged. Bisulfite-converted DNA samples were analyzed using the Infinium MethylationEPIC BeadChip Kit (Illumina). Bisulfite-converted DNA samples were denatured and neutralized by alkali. The denatured samples were then amplified by whole-genome amplification (37C overnight). Amplified DNA samples were enzymatically fragmented for 1h at 37C in a microsample incubator. 2-Propanol was added to the fragmented DNA samples and precipitated by centrifugation. Precipitated DNA samples were resuspended with hybridization buffer and incubated for 1h at 48C in a hybridization oven. Fragmented and resuspended DNA samples were denatured for 20min at 95C in a microsample incubator. Denatured DNA samples were dispensed onto BeadChips using a TECAN System. The BeadChips were incubated overnight at 48 C in the hybridization oven to hybridize the samples onto the BeadChips. After hybridization, seals were removed from the hybridized BeadChips. Next, unhybridized fragment DNAs were washed away. Labeled nucleotides were added to the washed BeadChips to extend primers which hybridized to the DNA. BeadChips were stained, then coated for protection, and dried. Dried BeadChips were scanned with the iSCAN System. Illumina GenomeStudio software (V2011.1) loaded the signal intensity files of BeadChips, and beta values were decided via normalization and background subtraction. Next, a comparative analysis was executed based on the Illumina Custom Model algorithm, and difference scores for all probes were computed. The markers with signal intensities adequate to distinguish between the signal and background noise were used in subsequent analysis. The markers with high scores (highly methylated and highly unmethylated compared to the reference sample) were extracted, and clustering analysis was conducted.

The NANOG binding consensus sequence is generally known to be 5TAAT[GT][GT]3 or 5[CG][GA][CG]C[GC]ATTAN[GC]3. Therefore, in the sequence of focus, the CGCCCAGTGTC part is quite similar to the binding sequence. We used Protein Data Bank data, including 4RBO, to predict binding conformations to the NANOG protein with the wild-type sequences or methylated sequence with our original method49. A sufficient amount of water molecules was placed around the complex structures, and thermodynamical sampling was performed under a periodic boundary condition. After stabilizing the complex structure by energy minimization calculations, some molecular dynamics simulations were performed at ~37C (310K) to capture the molecular behavior under the biological environment. After a sufficient thermal equilibration process, the molecular vibrations of the bonding configurations were sampled. All these calculations were performed using the AMBER package. The distributions of the interaction energy between DNA and NANOG protein were calculated by extracting 2000 conformations of complex structures from the trajectory with the abovementioned molecular dynamics simulations. Each binding energy was calculated using Gaussian program packages50 with the AMBER99 Force field level51.

603iCC cells (1104 per well) were seeded into 96-well plates and incubated for 48h. After incubation, cells were exposed to different concentrations of XAV939 (BD248591; BLD Phamatech Ltd., Shanghao, China) for 96h. The percentage of viable cells was determined using a cell counting kit solution (CCK-8; Dojindo Molecular Technologies) according to the manufacturers protocol.

Prior to cancer cell seeding, plates were coated. iPS cell-coated plates were seeded into 12-well plates (2105 iPS cells/well) 2 days prior to seeding. iPS cells were tagged with DsRed-Express by the aforementioned methods. Laminin coatings were prepared using iMatrix-511 (T304, Takara Bio) according to the manufacturers protocol. Sorted POU5F1-positive cells (2105/ well) were seeded on these plates. Medium was prepared with XAV939 (10M) for the XAV939 group and DMSO (0.3%) for the control group. All medium exchanges were performed every other day, and cells in the collected supernatant were analyzed by an SH800 cell sorter (SONY). Cells not expressing DsRED-Express2 were counted as cancer cells.

Stained specimens were analyzed using ImageJ software52. Five independent images were collected for each sample and the areas of protein expression in the samples were measured. The value was normalized by dividing by the number of cells stained with DAPI.

As an evaluation of XAV939, sorted POU5F1-positive cells were directly injected into the spleen of mice (1106 cells). After recovering from anesthesia, mice were randomly allocated to the control (0.3% DMSO that is the final concentration of DMSO in XAV939 group) or XAV939 group (100g/injection/mouse). XAV939 (CS-0494, ChemScene, Monmouth Junction, NJ, USA) was administered by intraperitoneal injection at 1mg/mL (injection volume, 100L) every day for 8 weeks, followed by 2 weeks of observation. Ten weeks after injection, mice were sacrificed for the assessment of metastases. Mouse body weight was measured twice per week, and no weight gain or loss greater than 5% was observed.

The Osaka University Review Board, the OICI Review Board, approved this study, and written informed consent for the study was obtained from all participants according to the ethics guidelines. All ethical regulations relevant to human research participants were followed. The OICI Animal Research Committee approved this study, and we have complied with all relevant ethical regulations for animal use. All experimental protocols were in accordance with the guidelines of the Osaka University, the OICI, and Declaration of Helsinki.

Continuous variables are expressed as the mean with standard error of the mean. The significance of the difference between the two groups was analyzed using the x2 test and Wilcoxons signed rank-sum test. All data were analyzed using JMP software (SAS Institute), R 3.6.3, and Prism 8 (GraphPad Software, San Diego, CA, USA). Results were considered statistically significant at P<0.05.

Originally posted here:
Metastases and treatment-resistant lineages in patient-derived ... - Nature.com

Evaluation of A-ring hydroxymethylene-amino- triterpenoids as … – Nature.com

World Health Organization: Coronavirus disease (COVID-19) situation report. https://www.who.int/emergencies/diseases/novel-coronavirus-2019/situation-reports. Accessed 21 Dec 2022.

Banerjee R, Perera L, Tillekeratne LMV. Potential SARS-CoV-2 main protease inhibitors. Drug Discov Today. 2021;26:80416. https://doi.org/10.1016/j.drudis.2020.12.005

Article CAS PubMed Google Scholar

Atanasov AG, Zotchev SB, Dirsch VM, Supuran CT. Natural products in drug discovery: advances and opportunities. Nat Rev Drug Discov. 2021;20:20016. https://doi.org/10.1038/s41573-020-00114-z

Article CAS PubMed PubMed Central Google Scholar

Battineni JK, Koneti PK, Bakshi V, Boggula N. Triterpenoids: a review. Int J Pharm Pharm Sci. 2018;2:9196.

Google Scholar

Hou W, Liu B, Xu H. Celastrol: progresses in structure-modifications, structure-activity relationships, pharmacology and toxicology. Eur J Med Chem. 2020;189:112081. https://doi.org/10.1016/j.ejmech.2020.112081

Article CAS PubMed Google Scholar

Hordyjewska A, Ostapiuk A, Horecka A, Kurzepa J. Betulin and betulinic acid: triterpenoids derivatives with a powerful biological potential. Phytochem Rev. 2019;18:92951. https://doi.org/10.1007/s11101-019-09623-1

Article CAS Google Scholar

Hussain H, Green IR, Ali I, Khan IA, Ali Z, Al-Sadi AM, Ahmed I. Ursolic acid derivatives for pharmaceutical use: a patent review (20122016). Expert Opin Ther Pat. 2017;27:106172. https://doi.org/10.1080/13543776.2017.1344219

Article CAS PubMed Google Scholar

Xiao S, Tian Z, Wang Y, Si L, Zhang L, Zhou D. Recent progress in the antiviral activity and mechanism study of pentacyclic triterpenoids and their derivatives. Med Res Rev. 2018;38:95176. https://doi.org/10.1002/med.21484

Article PubMed PubMed Central Google Scholar

Ryu YB, Park SJ, Kim YM, Lee JY, Seo WD, Chang JS, Park KH, Rho MC, Lee WS. SARS-CoV 3CLpro inhibitory effects of quinone-methide triterpenes from Tripterygium regelii. Bioorg Med Chem Lett. 2010;20:18736. https://doi.org/10.1016/j.bmcl.2010.01.152

Article CAS PubMed PubMed Central Google Scholar

Cinatl J, Morgenstern B, Bauer G, Chandra P, Rabenau H, Doerr HW. Glycyrrhizin, an active component of liquorice roots, and replication of SARS-associated coronavirus. Lancet. 2003;361:20456. https://doi.org/10.1016/S0140-6736(03)13615-X

Article CAS PubMed PubMed Central Google Scholar

Wu CY, Jan JT, Ma SH, Kuo C-J, Juan H-F, Cheng Y-SE, Hsu H-H, Huang H-C, Wu D, Brik A, Liang F-S, Liu R-S, Fang J-M, Chen S-T, Liang P-H, Wong C-H. Small molecules targeting severe acute respiratory syndrome human coronavirus. Proc Natl Acad Sci USA. 2004;101:100127. https://doi.org/10.1073/pnas.0403596101

Article CAS PubMed PubMed Central Google Scholar

Hoever G, Baltina L, Michaelis M, Kondratenko R, Baltina L, Tolstikov GA, Doerr HW, Cinatl J Jr. Antiviral activity of glycyrrhizic acid derivatives against SARS-coronavirus. J Med Chem. 2005;48:12569. https://doi.org/10.1021/jm0493008

Article CAS PubMed Google Scholar

Wen CC, Kuo YH, Jan JT, Liang PH, Wang SY, Liu HG, Lee CK, Chang ST, Kuo CJ, Lee SS, Hou CC, Hsiao PW, Chien SC, Shyur LF, Yang NS. Specific plant terpenoids and lignoids possess potent antiviral activities against severe acute respiratory syndrome coronavirus. J Med Chem. 2007;50:408795. https://doi.org/10.1021/jm070295s

Article CAS PubMed Google Scholar

Stevaert B, Krasniqi B, Van Loy B, Nguyen T, Thomas J, Vandeput J, Jochmans D, Thiel V, Dijkman R, Dehaen W, Voet A, Naesens L. Betulonic acid derivatives interfering with human coronavirus 229E replication via the nsp15 endoribonuclease. J Med Chem. 2021;64:563244. https://doi.org/10.1021/acs.jmedchem.0c02124

Article CAS PubMed Google Scholar

Krasilnikov IV, Kudriavtsev AV, Vakhrusheva AV, Frolova ME, Ivanov AV, Stukova MA, Romanovskaya-Romanko EA, Vasilyev KA, Mushenkova NV, Isaev AA. Design and immunological properties of the novel subunit virus-like vaccine against SARS-CoV-2. Vaccines. 2020;10:69. https://doi.org/10.3390/vaccines10010069

Article CAS Google Scholar

Yarovaya OI, Shcherbakov DN, Borisevich SS, Sokolova AS, Gureev MA, Khamitov EM, Rudometova NB, Zybkina AV, Mordvinova ED, Zaykovskaya AV, Rogachev AD, Pyankov OV, Maksyutov RA, Salakhutdinov NF. Borneol ester derivatives as entry inhibitors of a wide spectrum of SARS-CoV-2 viruses. Viruses. 2022;14:1295. https://doi.org/10.3390/v14061295

Article CAS PubMed PubMed Central Google Scholar

Kadela-Tomanek M, Jastrzebska M, Marciniec K, Chrobak E, Bebenek E, Boryczka S. Lipophilicity, pharmacokinetic properties, and molecular docking study on SARS-CoV-2 target for betulin triazole derivatives with attached 1,4-quinone. Pharmaceutics. 2021;13:781. https://doi.org/10.3390/pharmaceutics13060781

Article CAS PubMed PubMed Central Google Scholar

Tretyakova EV, Ma X, Kazakova OB, Shtro AA, Petukhova GD, Smirnova AA, Xu H, Xiao S. Abietic, maleopimaric and quinopimaric dipeptide Ugi-4CR derivatives and their potency against influenza A and SARS-CoV-2. Nat Prod Res. Published online: 17 Aug 2022. https://doi.org/10.1080/14786419.2022.2112040

Tretyakova EV, Ma X, Kazakova OB, Shtro AA, Petukhova GD, Klabukov AM, Dyatlov DS, Smirnova AA, Xu H, Xiao S. Synthesis and Evaluation of diterpenic mannich bases as antiviral agents against influenza A and SARS-CoV-2. Phytochem Lett 2022;51:9196. https://doi.org/10.1016/j.phytol.2022.07.010

Article CAS PubMed PubMed Central Google Scholar

Szostak M, Yao L, Aube J. Proximity effects in nucleophilic addition reactions to medium-bridged twisted lactams: remarkably stable tetrahedral intermediates. J Am Chem Soc. 2010;132:207884. https://doi.org/10.1021/ja909792h

Article CAS PubMed PubMed Central Google Scholar

Evans DA, Borg G, Scheidt KA. Remarkably stable tetrahedral intermediates: carbinols from nucleophilic additions to N-acylpyrroles. Angew Chem Int Ed. 2002;41:318891. 10.1002/1521-3773(20020902)41:17<3188::AID-ANIE3188>3.0.CO;2-H

Article CAS Google Scholar

Iwasawa T, Hooley RJ, Rebek J. Stabilization of labile carbonyl addition intermediates by a synthetic receptor. Science 2007;317:4936. https://doi.org/10.1126/science.11432

Article CAS PubMed Google Scholar

Hooley RJ, Restorp P, Iwasawa T, Rebek J. Cavitands with introverted functionality stabilize tetrahedral intermediates. J Am Chem Soc. 2007;129:1563943. https://doi.org/10.1021/ja0756366

Article CAS PubMed Google Scholar

Subik P, Welc B, Wisz B, Wolowiec S. Stable hemiaminals attached to PAMAM dendrimers. Tetrahedron Lett. 2009;50:65124. https://doi.org/10.1016/j.tetlet.2009.09.031

Article CAS Google Scholar

Barys M, Ciunik Z, Drabent K, Kwiecien A. Stable hemiaminals containing a triazole ring. N J Chem. 2010;34:260511. https://doi.org/10.1039/C0NJ00346H

Article CAS Google Scholar

Scott MS, Lucas AC, Luckhurst CA, Prodger JC, Dixon DJ. Ligand-mediated enantioselective addition of lithium carbazolates to aldehydes. Org Biomol Chem. 2006;4:131327. https://doi.org/10.1039/B515356E

Article CAS PubMed Google Scholar

Viuff AH, Besenbacher LM, Kamori A, Jensen MT, Kilian M, Kato A, Jensen HH. Stable analogues of nojirimycinsynthesis and biological evaluation of nojiristegine and manno-nojiristegine. Org Biomol Chem. 2015;13:963758. https://doi.org/10.1039/C5OB01281C

Article CAS PubMed Google Scholar

Giniyatullina GV, Flekhter OB, Baikova IP, Starikova ZA, Tolstikov GA. Effective synthesis of methyl 3-amino-3-deoxybetulinate. Chem Nat Comp. 2008;44:6035. https://doi.org/10.1007/s10600-008-9138-4

Article CAS Google Scholar

Smirnova A, Petrova A, Lobov E, Minnibaeva T, Tran Thi Phoung L, Tran Van M, Myint Khine M, Esaulkova I, Slita A, Zarubaev V, Kazakova O. Azepanodipterocarpol is potential candidate for inhibits influenza H1N1 type among other lupane, oleanane, and dammarane A-ring amino-triterpenoids. J Antibiot. 2022;75:25867. https://doi.org/10.1038/s41429-022-00514-w

Article CAS Google Scholar

Santos RC, Salvador JAR, Marn S, Cascante M. Novel semisynthetic derivatives of betulin and betulinic acid with cytotoxic activity. Bioorg Med Chem. 2009;17:624150. https://doi.org/10.1016/j.bmc.2009.07.050

Article CAS PubMed Google Scholar

Kazakova O, Rubanik L, Lobov A, Poleshchuk N, Baikova I, Kapustina Y, Petrova A, Korzun T, Lopatina T, Fedorova A, Rybalova T, Polovianenko D, Mioc M, oica C. Synthesis of erythrodiol C-ring derivatives and their activity against Chlamydia trachomatis. Steroids. 2021;175:108912. https://doi.org/10.1016/j.steroids.2021.108912

Article CAS PubMed Google Scholar

Si L, Bai H, Rodas M, Cao W, Oh CY, Jiang A, Moller R, Hoagland D, Oishi K, Horiuchi S, Uhl S, Blanco-Melo D, Albrecht RA, Liu W-C, Jordan T, Nilsson-Payant BE, Golynker I, Frere J, Logue J, Haupt R, McGrath M, Weston S, Zhang T, Plebani R, Soong M, Nurani A, Min Kim S, Zhu DY, Benam KH, Goyal G, Gilpin SE, Prantil-Baun R, Gygi SP, Powers RK, Carlson KE, Frieman M, tenOever BR, Ingber DE. A human-airway-on-a-chip for the rapid identification of candidate antiviral therapeutics and prophylactics. Nat Biomed Eng. 2021;5:81529. https://doi.org/10.1038/s41551-021-00718-9

Article CAS PubMed PubMed Central Google Scholar

Smee DF, Hurst BL, Evans WJ, Clyde N, Wright S, Peterson C, Jung KH, Day CW. Evaluation of cell viability dyes in antiviral assays with RNA viruses that exhibit different cytopathogenic properties. J Virol Methods. 2017;246:5157. https://doi.org/10.1016/j.jviromet.2017.03.012

Article CAS PubMed PubMed Central Google Scholar

Lopatina TV, Medvedeva NI, Baikova IP, Iskhakov AS, Kazakova OB. Synthesis and cytotoxicity of O- and N-acylderivatives of azepanobetulin. Russ J Bioorg Chem. 2019;45:292301. https://doi.org/10.1134/S106816201904006X

Article CAS Google Scholar

Kazakova OB, Rubanik LV, Smirnova IE, Savinova OV, Petrova AV, Poleschuk NN, Khusnutdinova EF, Boreko EI, Kapustina YM. Synthesis and in vitro activity of oleanane type derivatives against Chlamydia trachomatis. Org Commun. 2019;12:16975. https://doi.org/10.25135/acg.oc.66.19.07.1352

Article CAS Google Scholar

Kazakova OB, Brunel JM, Khusnutdinova EF, Negrel S, Giniyatullina GV, Lopatina TV, Petrova AV. A-ring modified triterpenoids and their spermidine-aldimines with strong antibacterial activity. Molbank. 2019;3:M1078. https://doi.org/10.3390/M1078

Article Google Scholar

Medvedeva NI, Kazakova OB, Lopatina TV, Smirnova IE, Giniyatullina GV, Baikova IP, Kataev VE. Synthesis and antimycobacterial activity of triterpeni A-ring azepanes. Eur J Med Chem. 2018;143:46472. https://doi.org/10.1016/j.ejmech.2017.11.035

Article CAS PubMed Google Scholar

Kazakova O, Smirnova I, Lopatina T, Giniyatullina G, Petrova A, Khusnutdinova E, Csuk R, Serbian I, Loesche A. Synthesis and cholinesterase inhibiting potential of A-ring azepano- and 3-amino-3,4-seco-triterpenoids. Bioorg Chem. 2020;101:104001. https://doi.org/10.1016/j.bioorg.2020.104001

Article CAS PubMed Google Scholar

Ma C, Nakamura N, Hattori M. Chemical modification of oleanene type triterpenes and their inhibitory activity against HIV-1 protease dimerization. Chem Pharm Bul. 2000;48:16818. https://doi.org/10.1248/cpb.48.1681

Article CAS Google Scholar

Jain SM, Atal CK. Synthesis of amino derivatives of ursolic acid. Ind J Chem., Section B 25B. 1986;4:427-8.

Schrdinger Release 2018-4: LigPrep, Schrdinger, LLC, New York, NY; 2018.

Schrdinger Release 2018-4: induced fit docking protocol; glide, Schrdinger, LLC, New York, NY, 2018; Prime, Schrdinger, LLC, New York, NY; 2018.

Case DA, Darden TA, Cheatham TE, Simmerling CL, Wang J, Duke RE, Luo R, Walker RC, Zhang W, Merz KM, Roberts B, Wang B, Hayik S, Roitberg A, Seabra G, Kolossvry I, Wong KF, Paesani F, Vanicek J, Liu J, Wu X, Brozell SR, Steinbrecher T, Gohlke H, Cai Q, Ye X, Wang J, Hsieh M-J, Cui G, Roe DR, Mathews DH, Seetin MG, Sagui C, Babin V, Luchko T, Gusarov S, Kovalenko A, Kollman PA. Amber 14 reference manual, University of California, San Francisco, 2014.

Continued here:
Evaluation of A-ring hydroxymethylene-amino- triterpenoids as ... - Nature.com

On this day: Mahmoud Abbas becomes leader of Fatah in 2004 – In-Cyprus

Following are some of the major events to have occurred on November 25:

1935 King George II returns to Greece as monarch.

1936 Germany and Japan sign anti-Comintern pact.

1952 Agatha Christies play The Mousetrap opened in London. Still playing to audiences today, it holds the record for the longest continuous run of any show in the world.

1963 U.S. President John F. Kennedy was buried with full military honours at Arlington National Cemetery, three days after his assassination.

1974 The Burmese diplomat U Thant died. He became U.N. secretary-general after the death of Dag Hammarskjold in 1961, and held the post until 1971.

1997 Malawis former leader, Kamuzu Banda, died aged 99. As Hastings Banda, he became president in 1966 and proclaimed himself ruler for life in 1971. He was defeated in 1994 in Malawis first democratic election.

1999 Six-year-old Cuban Elian Gonzalez survives smuggling boat shipwreck on its way to the United States, sparking a controversial custody case between the two countries.

2001 Advanced Cell Technology Inc. of Massachusetts became the first organisation to report the successful cloning of a human embryo. The company said it did not intend to create a human being but to use the stem cells to treat disease.

2004 The dominant Palestinian political faction, Fatah, approved Mahmoud Abbas as its candidate to succeed Yasser Arafat, who had died on Nov. 11.

2005 Richard Burns, the only Englishman to win the world rally championship, died of a brain tumour at the age of 34.

2015 Pope Francis arrives in Kenya on historic African visit.

(Reuters)

The rest is here:
On this day: Mahmoud Abbas becomes leader of Fatah in 2004 - In-Cyprus